ID: 1020372747

View in Genome Browser
Species Human (GRCh38)
Location 7:7452086-7452108
Sequence AAATATATACTCCACTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020372747_1020372750 -1 Left 1020372747 7:7452086-7452108 CCACCCTAGTGGAGTATATATTT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1020372750 7:7452108-7452130 TTAGAGCAGCACTGTCCAAGAGG 0: 1
1: 0
2: 2
3: 34
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020372747 Original CRISPR AAATATATACTCCACTAGGG TGG (reversed) Intronic
904955793 1:34282969-34282991 GAATATAAGCCCCACTAGGGTGG + Intergenic
905730875 1:40298827-40298849 GAATATAAGCTCCACGAGGGTGG - Intergenic
909626481 1:77722053-77722075 AAGCATATGCTCCACAAGGGTGG - Exonic
911607787 1:99928263-99928285 AAATATATGCTTCCCTGGGGGGG + Intergenic
911771502 1:101748450-101748472 AAATATAAACTCCATGAGTGTGG + Intergenic
912347055 1:108973405-108973427 AAATATAAGCTCCATCAGGGAGG + Intronic
912424245 1:109572401-109572423 AAATATTTTCTTCACTAGGCAGG - Intronic
916867869 1:168879667-168879689 ATATATATACTCCTATAGAGAGG - Intergenic
919113138 1:193244885-193244907 GAATATAAACTCCCTTAGGGTGG + Intronic
920364843 1:205442714-205442736 CTATATATACTCCACCAGAGTGG - Intronic
923640680 1:235756696-235756718 AAATATAAGCTCCATGAGGGTGG - Intronic
924147958 1:241096742-241096764 AATTTTAGACTCCACTAGAGTGG + Intronic
1064769927 10:18712577-18712599 AAACAGATACTCTACTAGGAAGG - Intergenic
1066291548 10:34018849-34018871 AAGCTTATACTCCACTGGGGAGG - Intergenic
1070636924 10:78136382-78136404 AAATATAAACTCTAGTAGGTTGG - Intergenic
1070654200 10:78259970-78259992 AAATAGCTACTCCACTAGCCTGG + Intergenic
1071195271 10:83151988-83152010 AAATATCTACTCTACTGGAGAGG + Intergenic
1073720421 10:106163174-106163196 AAATATAAAATCCACTAGAGAGG + Intergenic
1075534737 10:123261122-123261144 ATATATATATTCCATGAGGGTGG - Intergenic
1076115430 10:127893254-127893276 AAACATATACTTCACTATTGTGG + Intergenic
1077513149 11:2982532-2982554 CAAGAGAAACTCCACTAGGGAGG + Intronic
1079591105 11:22183802-22183824 AAATATATAATTAAGTAGGGTGG + Intergenic
1081797811 11:45833728-45833750 TAATATAGAGTCCACTATGGAGG + Intergenic
1082773479 11:57227742-57227764 AAATAGATACACCAATATGGTGG - Intergenic
1082875987 11:57989332-57989354 AAATATATAGACCACTAGCCAGG - Intergenic
1083564765 11:63704297-63704319 AAAATTATACTCCTCTAGGCTGG - Intronic
1083691387 11:64411056-64411078 AAATATAAGCTCCATGAGGGTGG - Intergenic
1087395075 11:97586759-97586781 AAATCTAAAATGCACTAGGGTGG - Intergenic
1091572367 12:1699110-1699132 AAATATATAGTCTATTAGGCAGG - Intronic
1093272992 12:17088926-17088948 AAAAATCTACTGCACTAGGGAGG - Intergenic
1096302823 12:50446721-50446743 AAAAATACAGTCCACTAGGCCGG - Intronic
1096524319 12:52201443-52201465 AAATATCTCCTCCACATGGGTGG - Intergenic
1097980788 12:65736225-65736247 AAATATAAACCCCACAAAGGTGG - Intergenic
1101561939 12:105864966-105864988 AAATCTATTCTCTACAAGGGAGG + Intergenic
1106598545 13:31167836-31167858 TAATTAATAATCCACTAGGGAGG + Intergenic
1107314212 13:39113645-39113667 AAATATAAGCTCCATGAGGGTGG + Intergenic
1107314505 13:39116867-39116889 AAATATGTAGGCCACTAGTGAGG - Intergenic
1108404805 13:50089985-50090007 AAATACATCCTCCAATAAGGGGG - Intronic
1108641911 13:52390879-52390901 AAATAAAAATTCCACTAGTGAGG + Intronic
1109665081 13:65523935-65523957 AAAAATAGACTTCACTTGGGAGG + Intergenic
1109831935 13:67802262-67802284 AGGGATATCCTCCACTAGGGAGG - Intergenic
1110382929 13:74875250-74875272 AAATATATACTGGAATAGAGTGG + Intergenic
1110729901 13:78867752-78867774 AAATATAGATTCCACACGGGGGG + Intergenic
1112552745 13:100436866-100436888 AAATCCATACTCCATTAGTGTGG + Intronic
1114885680 14:26846919-26846941 AAATATATAATCCACAATTGTGG - Intergenic
1117301085 14:54429048-54429070 TAATACATACTCAACTAGAGAGG - Intronic
1117704904 14:58455118-58455140 AAATGTATAATTCACTAGAGGGG - Intronic
1117788597 14:59314267-59314289 TAACATCTTCTCCACTAGGGTGG + Intronic
1118931393 14:70244868-70244890 AAATATAATCTCCATGAGGGTGG - Intergenic
1118953771 14:70460274-70460296 AAATATAATCTCCATGAGGGTGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1129174352 15:73829390-73829412 AAATATTTATTGCACTAGGCAGG + Intergenic
1133387412 16:5381081-5381103 AAATAGATACGCCACTGGAGAGG + Intergenic
1139015829 16:62687595-62687617 AACTGTCTACTCCACTAGTGTGG - Intergenic
1141010476 16:80392494-80392516 AAATATATACTATACTGGTGAGG + Intergenic
1156101656 18:33603610-33603632 AAATAGATCCACCACTAGGAAGG + Intronic
1157723020 18:49940050-49940072 CAGTAAATACTCCACTAGGCTGG - Intronic
1163577390 19:18118630-18118652 AAATATTTACTGCACGAGGCTGG + Intronic
925444867 2:3919104-3919126 GAATACAAACTCCACAAGGGCGG - Intergenic
925894141 2:8458289-8458311 AAATAAATACTGCAATAGTGGGG - Intergenic
929245717 2:39700632-39700654 AAATATATACTCCAATAAAAAGG - Intronic
939693736 2:145297802-145297824 AAGAATATACTCCATTAGGAGGG + Intergenic
940353266 2:152712662-152712684 AAATAAAGACTCAAATAGGGAGG + Intronic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
945037389 2:205715748-205715770 AAATATCCACTCCACAAGGCTGG - Intronic
946496353 2:220199909-220199931 AAATGTATAATCCACTAGCTAGG + Intergenic
1168816872 20:743677-743699 AAATACAAACTCCAGTAGTGTGG - Intergenic
1169306177 20:4492467-4492489 TAATAAATACTCCATGAGGGGGG + Intergenic
1170875701 20:20248018-20248040 TAATATAAACACCACAAGGGCGG + Intronic
1172848201 20:37942871-37942893 AACTATTCACTCCACTTGGGGGG - Intronic
1177500653 21:21950273-21950295 AAATAAATAATCCAGTAGAGAGG + Intergenic
1182982846 22:34687964-34687986 AAATATAAACTCCATAAGGATGG - Intergenic
1184824190 22:46936092-46936114 TAATAAATTCTCCACTAAGGTGG - Intronic
950595442 3:13976579-13976601 AACTATATTCTCCACTATGGGGG + Intronic
951949219 3:28180746-28180768 AAATATTTCTTCCACTAGAGAGG - Intergenic
956243711 3:67157523-67157545 AAATAGATACACCACTAGCCAGG + Intergenic
957195295 3:77059923-77059945 GAGTATATACTACACCAGGGGGG + Intronic
957892541 3:86378607-86378629 AAAAATATATTCCATTATGGTGG - Intergenic
959794013 3:110400529-110400551 AAATAAATAATTCACTAGAGGGG - Intergenic
960692861 3:120365312-120365334 AAATATGGACTCCAGTAGGAAGG - Intergenic
961935137 3:130574936-130574958 AAAGATATAAACCTCTAGGGAGG - Intronic
966579811 3:181547774-181547796 AAATAGATACTTCTCTAAGGAGG - Intergenic
967483499 3:190002847-190002869 AAATATATACTCCCATAGTAAGG + Intronic
968390791 4:191569-191591 AAATATATACTTTACAAGGATGG + Intergenic
969069261 4:4520839-4520861 AAAGATATATTTCACTAGGCAGG - Intronic
969205280 4:5639253-5639275 GAACATCTACTCCCCTAGGGAGG - Intronic
970816571 4:20162936-20162958 AGAATTCTACTCCACTAGGGCGG + Intergenic
971099548 4:23448593-23448615 AAATAGATACTTCACTGTGGAGG - Intergenic
972710891 4:41593529-41593551 AAAGATATATTCAACTAGGTAGG - Intronic
975077252 4:70226389-70226411 AAATATTTACTACAGCAGGGTGG - Intronic
975447211 4:74479942-74479964 AAATATATATTCCAGTGGGAAGG + Intergenic
980997155 4:139790204-139790226 ATATATATATGTCACTAGGGTGG - Intronic
984739993 4:183152210-183152232 AAATATATAGCCCACCATGGTGG + Intronic
987744644 5:21954201-21954223 AAATATATACTTAGCTAGAGAGG + Intronic
987765666 5:22226151-22226173 AAAGATATACTCTGCAAGGGCGG + Intronic
989808675 5:45645326-45645348 AAAGATATAATCCACTGGGATGG + Exonic
991764852 5:69964327-69964349 AAATATATACTTAGCTAGAGAGG + Intergenic
991782472 5:70153826-70153848 AAATATATACTTAGCTAGAGAGG - Intergenic
991844084 5:70839398-70839420 AAATATATACTTAGCTAGAGAGG + Intergenic
991874915 5:71154139-71154161 AAATATATACTTAGCTAGAGAGG - Intergenic
993046979 5:82878639-82878661 AAATATATATTCACCTAGGAAGG - Intergenic
994247341 5:97494381-97494403 AATTATATGCTCCATTAGGAAGG - Intergenic
998539658 5:142968583-142968605 AAATATATACACAACCAGAGAGG - Intronic
998615090 5:143731268-143731290 AAATATGTACTTCAATAAGGAGG - Intergenic
999228736 5:150048953-150048975 AAATATACGGTCAACTAGGGAGG - Intronic
1002676758 5:180922099-180922121 AAATATATAGACCACTAGCTAGG - Intronic
1007200261 6:40102040-40102062 AAAATTAAACTCCACTAGAGAGG - Intergenic
1007801669 6:44399619-44399641 AAATGTAAACTTCACTAGAGAGG - Intronic
1008122392 6:47633463-47633485 ACATCAATACTCAACTAGGGAGG - Intergenic
1009825508 6:68861192-68861214 AAATATCCACTCTACTAGAGTGG - Intronic
1012236661 6:96825191-96825213 CAATATATATTCAATTAGGGCGG + Intronic
1013454899 6:110321824-110321846 AAATATATTCTCTCCTACGGAGG + Intronic
1014665731 6:124234851-124234873 AAATACACACTGCACTTGGGAGG - Intronic
1015649618 6:135441192-135441214 AAATAAATAATTCACTAGAGGGG + Intronic
1016394746 6:143611716-143611738 AAATATATGCTCCAGCAGCGTGG + Intronic
1017094325 6:150791041-150791063 GAATATATACTCCTCTGGGGAGG + Intronic
1017720066 6:157237531-157237553 AAGGATAAACTCCTCTAGGGAGG + Intergenic
1018518910 6:164621676-164621698 AAATATATTTTCCACAAGGATGG - Intergenic
1019989034 7:4679730-4679752 AACTATAAGCTCCACCAGGGAGG + Intergenic
1020372747 7:7452086-7452108 AAATATATACTCCACTAGGGTGG - Intronic
1023520426 7:41045285-41045307 CAGTTTATACTCCAATAGGGTGG + Intergenic
1024103115 7:46053664-46053686 AAATATAAAATTCACTAGAGAGG - Intergenic
1025008823 7:55378834-55378856 AAAAATATACTCCAGTAGGCTGG + Intronic
1025987872 7:66471599-66471621 AAAGAAATACTCCACTAGTGGGG - Intergenic
1027210857 7:76147514-76147536 AAAAAAAAACTCCACTAGTGGGG - Intergenic
1027363541 7:77433560-77433582 AAATATACATTCCCCTAGGAAGG + Intergenic
1029012951 7:97281991-97282013 AAATGTATACTTCACCATGGTGG + Intergenic
1030736622 7:113056238-113056260 ATATATATATTCCAATAGTGAGG - Intergenic
1031684586 7:124717425-124717447 AAAAATTTATTCCACTTGGGAGG + Intergenic
1032707052 7:134430245-134430267 AAATAAATTCTCCAGAAGGGGGG - Intergenic
1036773617 8:11595102-11595124 GAATATATACTGCAGGAGGGGGG - Intergenic
1040767654 8:50934011-50934033 AAATATATTATCCATAAGGGTGG + Intergenic
1041308022 8:56483796-56483818 GAATATATTCTCCACTTGGAAGG + Intergenic
1043306529 8:78803283-78803305 AAAAATAGACTCTACTCGGGAGG - Intronic
1044837669 8:96312161-96312183 AAAGGTAAACTCCACTATGGCGG + Intronic
1045042673 8:98241764-98241786 AAATATATACACAATAAGGGTGG + Intronic
1046101685 8:109621642-109621664 ATTTATAAACTCCACCAGGGTGG - Intronic
1055011089 9:71566344-71566366 AAATATATAATCAGCTATGGGGG + Intergenic
1057388398 9:94623815-94623837 GAATATACGCTCCACAAGGGCGG - Intronic
1061116066 9:128613022-128613044 AAATATATACACCAAAAGGCTGG - Intronic
1186020531 X:5250458-5250480 TAATATATATTCCACTAGGTTGG + Intergenic
1194038652 X:88913320-88913342 AAATATATTCTGCATTTGGGGGG - Intergenic
1194361618 X:92958754-92958776 AAATATATATTACACTACTGGGG + Intergenic
1194962184 X:100248444-100248466 AAAAATAAACTCCACAAGGAAGG + Intergenic
1196057689 X:111373683-111373705 AAATATTTACTCCACTTGTAGGG - Intronic
1197264225 X:124348718-124348740 AAATATAATCTCCATGAGGGCGG + Intronic
1198302628 X:135346229-135346251 AAAAATACACTGCAATAGGGAGG - Intronic
1200669811 Y:6074628-6074650 AAATATATATTACACTAGTGGGG + Intergenic
1201360071 Y:13136805-13136827 AAATAAAAAATCCACTAGGGAGG + Intergenic