ID: 1020372770

View in Genome Browser
Species Human (GRCh38)
Location 7:7452344-7452366
Sequence ACTGGTCCTCGAGGGCCTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020372762_1020372770 3 Left 1020372762 7:7452318-7452340 CCTTTGGACCTTGTACTCCAATT 0: 1
1: 0
2: 0
3: 19
4: 278
Right 1020372770 7:7452344-7452366 ACTGGTCCTCGAGGGCCTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 87
1020372763_1020372770 -5 Left 1020372763 7:7452326-7452348 CCTTGTACTCCAATTCCCACTGG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1020372770 7:7452344-7452366 ACTGGTCCTCGAGGGCCTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020372770 Original CRISPR ACTGGTCCTCGAGGGCCTGT AGG Exonic