ID: 1020372779

View in Genome Browser
Species Human (GRCh38)
Location 7:7452436-7452458
Sequence GGTTTTAGGAGATCAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020372779 Original CRISPR GGTTTTAGGAGATCAACAGC AGG (reversed) Intronic
904074474 1:27829785-27829807 GGTTTTAAGAGACCATTAGCAGG - Intergenic
906846788 1:49201038-49201060 GGTTTTAGGAGATGGATATCAGG + Intronic
910208311 1:84769799-84769821 GGTGTTGGCAGATTAACAGCAGG - Intergenic
916257084 1:162799990-162800012 CTTATTAGGAAATCAACAGCAGG - Intronic
917464885 1:175267345-175267367 GGTTTTAGGAGATGAATGTCAGG + Intergenic
919525570 1:198645131-198645153 CGTATTAGGATATGAACAGCTGG + Intronic
1066723543 10:38365680-38365702 CTTATTAGGAAATCAACAGCAGG - Intergenic
1067349086 10:45459395-45459417 GGTTTTAGGAGAACAATACTTGG - Intronic
1070510353 10:77155270-77155292 ACTTTTTGGAGATCAATAGCAGG - Intronic
1073036092 10:100565118-100565140 ACTTTTAGGAGATCAAAACCTGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085563530 11:77492499-77492521 GGTATTAGGAGATTAAAAGATGG + Intergenic
1086851113 11:91810241-91810263 TGTTAGAGGACATCAACAGCAGG - Intergenic
1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG + Exonic
1100434629 12:94560583-94560605 GGGTTTAGGACAGCAGCAGCTGG + Intergenic
1104844300 12:131838999-131839021 GGTTTGTGGATATCTACAGCAGG - Intronic
1105652386 13:22393459-22393481 GGTTTTAGGAGTACTACAGAGGG + Intergenic
1110165278 13:72434445-72434467 TGTTTTAGGTGAGAAACAGCAGG - Intergenic
1114479956 14:23026748-23026770 GGTTTTAAGAGAACTACTGCTGG - Intronic
1114731853 14:25001326-25001348 GGTTTTAGGAGATCTATGCCAGG - Intronic
1118209619 14:63753241-63753263 GGTTTTAGGAGTCTTACAGCTGG - Intergenic
1118680498 14:68236579-68236601 AGTTTTAGGAGTTCACCAACAGG + Intronic
1121248669 14:92483456-92483478 GGGCTTAGGAGATCAATACCTGG - Intronic
1121528502 14:94636723-94636745 GGTTTTAGGAAGTCAACAAGAGG + Intergenic
1121600601 14:95200237-95200259 GGATTCAGGAGTTCAACAGAAGG - Intronic
1135620161 16:23948949-23948971 GGTTTCATGAGATCTACACCTGG + Intronic
1140196493 16:72859759-72859781 GGTTAGAGGAAATGAACAGCTGG + Intronic
1142931584 17:3289521-3289543 GATCTTTGGAGATAAACAGCAGG + Intergenic
1147808956 17:43153110-43153132 GGATTTAGGAGACGAACTGCTGG + Intergenic
1149060598 17:52416861-52416883 GGTTTTGTGAGATTAACACCTGG + Intergenic
1150574047 17:66414096-66414118 GGTTTCAGGAGCTCTACATCAGG + Intronic
1157009408 18:43628202-43628224 GGTTTTAGGACCTCACCAGGTGG - Intergenic
1158890181 18:61865092-61865114 GGTTTTAGGAGCTCAGTACCAGG + Intronic
1159702213 18:71642548-71642570 GGCTTTAGAAGATAAACAGAAGG - Intergenic
1162853950 19:13453999-13454021 GGTTTTAGGAGCTGTACACCAGG - Intronic
925016366 2:527742-527764 GGTGTTAGGAGCTCAGCAGGTGG + Intergenic
928022875 2:27717147-27717169 GTTTTCAGGAGAGCAACAGCTGG - Intergenic
931906741 2:66850721-66850743 GGTCTCAGGAGGTCAGCAGCGGG - Intergenic
933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG + Intronic
939763222 2:146211084-146211106 GGTTGTTGGATTTCAACAGCTGG + Intergenic
943179410 2:184524461-184524483 GGTGATAGGAGACCAACAGTGGG + Intergenic
1179816528 21:43909753-43909775 GCTTCTCGGAGATCCACAGCCGG - Intronic
1183818092 22:40320908-40320930 TGTTTTAAGAGATAAACAGGTGG - Intronic
1185122607 22:48981361-48981383 GAATTTAGGAAATCAGCAGCTGG + Intergenic
951887006 3:27534193-27534215 GGATTGAGAAGACCAACAGCAGG - Intergenic
952591453 3:34959918-34959940 GGTTGTAGGAAATAAACTGCTGG + Intergenic
953962506 3:47277944-47277966 GGTTTTAGGAGAGCAAGAGGAGG - Intronic
955897296 3:63714079-63714101 GGTTTGAGGAGATCGACATTAGG - Intergenic
960472073 3:118077887-118077909 TGTTTTAGGAGATAAACAATAGG - Intergenic
963385371 3:144585872-144585894 AGTTTTAAGAGATCAGCAGAGGG + Intergenic
966081302 3:176005066-176005088 GGATTTAAGAAATGAACAGCTGG + Intergenic
971030352 4:22630326-22630348 GTTTATTGGCGATCAACAGCAGG - Intergenic
974354163 4:60790677-60790699 GGTTTTAGGAGCTCTGCAACAGG - Intergenic
977697557 4:99983102-99983124 TTTTTTAGGAGATAAAAAGCCGG - Intergenic
980160865 4:129160814-129160836 TGGTTTAGAAGATCAACTGCAGG + Intergenic
980642599 4:135599063-135599085 GGTTTTAGGAGGAAAACAGAGGG - Intergenic
981247209 4:142554421-142554443 GATTTGAGGAGATCAAGAGTAGG - Intronic
982994255 4:162320521-162320543 ATTTTTAGGATAACAACAGCAGG + Intergenic
984183460 4:176513070-176513092 GGATTTAGGAGCTCAGCACCAGG + Intergenic
992388247 5:76306378-76306400 GGTTTTAGGAGCTCAATGCCGGG + Intronic
995926053 5:117375918-117375940 GCTTTTAGGTGAGCAACAGCAGG - Intergenic
1004194881 6:13494286-13494308 TGTTGTTGGAGAGCAACAGCAGG - Intergenic
1008327242 6:50197693-50197715 CATTTTAGGAGATAAGCAGCAGG + Intergenic
1011821636 6:91260245-91260267 GATTTTAGGAGTTGTACAGCAGG - Intergenic
1013452533 6:110298977-110298999 GGTTTTTGGGCAGCAACAGCTGG + Exonic
1014014750 6:116517651-116517673 GGTTTTAGGAGCTCTGCACCAGG - Exonic
1020372779 7:7452436-7452458 GGTTTTAGGAGATCAACAGCAGG - Intronic
1024484507 7:49902707-49902729 GTTGTTAGGACATCAAAAGCAGG + Intronic
1024965948 7:55021966-55021988 GGTTTCAGGAGATCCAAATCAGG + Intronic
1025070879 7:55897848-55897870 GGTTTTAGGAGCTCTGCGGCAGG - Intronic
1028733484 7:94179916-94179938 GTTATTAGGAGACCAACACCAGG - Intergenic
1030668593 7:112309216-112309238 GGCTTCAGGAGATCATCAGGAGG - Intronic
1031814893 7:126421667-126421689 GGTTTGAAGAGATCAAGAGCAGG + Intergenic
1035739536 8:1915735-1915757 GTCTTTAGGAGCTCAACAGGAGG + Intronic
1043486603 8:80704417-80704439 GATTTTAGGAGTTGTACAGCAGG - Intronic
1046903055 8:119543314-119543336 TGTTTTAGAACTTCAACAGCAGG + Intergenic
1051939398 9:22486961-22486983 GGTGTTAAGAGGTCAAAAGCGGG + Intergenic
1058678091 9:107418260-107418282 GGTTTTAGCGGATCTACAGAGGG - Intergenic
1058835202 9:108854263-108854285 GGTTGGAGGAGATGCACAGCTGG - Intergenic
1059100968 9:111470950-111470972 GGTTTTAGGAGGTGACAAGCAGG + Intronic
1185616628 X:1425960-1425982 GGGATTAGGAGTTCAACATCTGG - Intronic
1187954282 X:24500731-24500753 GGTTGTATGGGATCACCAGCAGG + Intronic
1193347604 X:80422598-80422620 GGTTTGAGGAGAGCAGCAGTTGG + Intronic
1193820757 X:86161379-86161401 GGTGTTAGCAGATCAAAACCTGG + Intronic
1198240108 X:134777033-134777055 GGTTCTATCAGATTAACAGCAGG + Intronic
1198592090 X:138195012-138195034 GGGAATAGGAGATCCACAGCAGG + Intergenic