ID: 1020378771

View in Genome Browser
Species Human (GRCh38)
Location 7:7518585-7518607
Sequence AAAATTAGGCAATAAGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 470}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020378771 Original CRISPR AAAATTAGGCAATAAGTAAG AGG (reversed) Intronic
900711039 1:4114328-4114350 AAAATTATCCCACAAGTAAGAGG - Intergenic
903915577 1:26761825-26761847 CAAATGAGGCAAAATGTAAGGGG - Intronic
904061675 1:27715812-27715834 AAAATGAGGCAATAGTTGAGGGG - Intergenic
905944650 1:41891283-41891305 AAAATTGGGAAATAAGTTTGGGG - Intronic
905992371 1:42349421-42349443 AAAAGGAGGCAATAAAGAAGTGG - Intergenic
907143950 1:52215421-52215443 AAAATAAGAGAATAAGTAAAAGG - Intronic
908487125 1:64605751-64605773 AAAATAAGGCAATGAGGATGAGG - Intronic
908549240 1:65192770-65192792 AGAAATAGGCAAGAAGAAAGGGG + Intronic
908821366 1:68090217-68090239 AAATTGAGGCAATAACTAATAGG - Intergenic
908901038 1:68956740-68956762 AAAATTATGAAGGAAGTAAGTGG - Intergenic
909204421 1:72736957-72736979 AAAATCTGAAAATAAGTAAGTGG - Intergenic
909328907 1:74388861-74388883 CAAATTAGGCAATAAGTAGCTGG + Intronic
909782599 1:79565056-79565078 AAAATTATGGAATAAATAAATGG - Intergenic
909875608 1:80798627-80798649 AAAAGTGGGTAATAAGAAAGTGG - Intergenic
910336171 1:86134000-86134022 AAATTGAGGCAATAATTAATAGG - Intronic
910752240 1:90644386-90644408 AAAATTAGAAAATTAATAAGTGG + Intergenic
911056502 1:93712863-93712885 AAAACTAGGCAACAAGTGAAGGG - Intronic
911091987 1:94024543-94024565 AAAAAGAGAAAATAAGTAAGTGG - Intronic
911702429 1:100969127-100969149 AAAATTCTGAAATAAATAAGTGG - Intronic
911963286 1:104334660-104334682 AAATTGAGGCAATAATTAATAGG - Intergenic
912486345 1:110032046-110032068 AAAAATAGCCAATAAGAAAATGG - Intronic
913138511 1:115916199-115916221 AAAATTAGTAAATCATTAAGAGG + Intergenic
913377684 1:118172265-118172287 AAAATTAGGCAAATACTAATAGG + Intronic
913512830 1:119577681-119577703 AAATTGAGGCAATAATTAATAGG + Intergenic
913972926 1:143429784-143429806 AAAATGATACAATAAGTAAAGGG - Intergenic
914067310 1:144255391-144255413 AAAATGATACAATAAGTAAAGGG - Intergenic
914111843 1:144710963-144710985 AAAATGATACAATAAGTAAAGGG + Intergenic
915141401 1:153770810-153770832 AAAATATGGCAATAAGGAGGAGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
916310409 1:163392190-163392212 AGAGTTAGGCAATAAATCAGTGG + Intergenic
916421717 1:164643794-164643816 AAAATTATGTAACCAGTAAGTGG + Intronic
916667283 1:166977458-166977480 AAGATCAGGCAACTAGTAAGTGG + Intronic
916906760 1:169294480-169294502 AAAATTAGACAATAACTAATAGG + Intronic
917439009 1:175049840-175049862 AAAACTGGGGAATGAGTAAGAGG + Intergenic
917552413 1:176047396-176047418 AAAGTTAGTCAATCTGTAAGTGG + Intronic
917652693 1:177094739-177094761 CAAATTGGGTAATGAGTAAGAGG + Intronic
917940195 1:179911683-179911705 AAGATTACTCAATTAGTAAGTGG - Intronic
918898533 1:190380839-190380861 AAAATTAGCAAATAAATTAGTGG + Intronic
921240247 1:213173026-213173048 AAAAGTAGGTAATAGATAAGAGG - Intronic
921407474 1:214796885-214796907 AAAAGTAAGCAATAAATAAACGG + Intergenic
921505948 1:215970550-215970572 AATATTAAGGAAGAAGTAAGTGG - Intronic
921854377 1:219965493-219965515 CAAATTAGGCAATCACTCAGTGG - Intergenic
922520591 1:226247607-226247629 AAAAGAAGGAAAGAAGTAAGGGG - Intronic
924356814 1:243186979-243187001 AAAATTTTGCAATAATTAATGGG - Intronic
924631905 1:245748729-245748751 AGAATTAGGAAATAATAAAGAGG + Intergenic
1062884824 10:1008630-1008652 AAAATTATGGAAGAAGAAAGTGG - Intronic
1063085428 10:2813708-2813730 AAAATGTGGCAGCAAGTAAGGGG - Intergenic
1063137471 10:3229839-3229861 AAAATTATAAAATAAGTAAAGGG + Intergenic
1064539826 10:16394119-16394141 AAAATATGGCAATAAGTAGCAGG + Intergenic
1064775454 10:18772153-18772175 ATAGTTAGGGAATAAGTAACCGG - Intergenic
1064910139 10:20392275-20392297 AAATTTAGGCAGTAAGGAAGAGG + Intergenic
1066432032 10:35361179-35361201 AAAATGAAACAATAAATAAGTGG - Intronic
1068065068 10:52120567-52120589 AAAAATAGGCAAGAAGAAAGGGG + Intronic
1068075939 10:52254017-52254039 ATTATCAGGCAATTAGTAAGTGG - Intronic
1068126084 10:52843560-52843582 AAATTGAGGCAATAATTAATAGG - Intergenic
1068293317 10:55033493-55033515 AGAAGTAGGCAAGAAGAAAGGGG - Intronic
1068711721 10:60142130-60142152 AAAAATAGCCAAGAAGTCAGTGG - Intronic
1069028189 10:63566939-63566961 AAAATTAGGGAATAGGGAAGAGG - Intronic
1069160650 10:65087218-65087240 AAAAATAGGCAATAAGCATATGG - Intergenic
1069202674 10:65641400-65641422 AAGATTAGGAAATAAGTAAGTGG + Intergenic
1069425296 10:68283491-68283513 AAAATGAGTCAATAACTATGTGG - Exonic
1071197811 10:83181756-83181778 ACAAGTAGGGAATAAGGAAGAGG + Intergenic
1071359645 10:84833358-84833380 AGAAATAGGCAAGAAGAAAGGGG - Intergenic
1071400975 10:85270468-85270490 AAATTTAGTAAAGAAGTAAGTGG + Intergenic
1071882402 10:89913644-89913666 AAAATTACTCAATAAGGCAGAGG + Intergenic
1072311681 10:94162307-94162329 AAATTGAGGCAATAATTAATAGG - Intronic
1072840914 10:98772698-98772720 CAAATCAGTCAATAAGTAATAGG - Intronic
1073298238 10:102454257-102454279 AATATTGGGCAAAAAGTGAGTGG + Intergenic
1073722018 10:106183455-106183477 AAAATAAGGCAATCTATAAGTGG - Intergenic
1073876624 10:107930660-107930682 AAAGTTACACTATAAGTAAGTGG - Intergenic
1074283517 10:112076195-112076217 AGAGTTAGGAAATTAGTAAGTGG - Intergenic
1074312424 10:112333670-112333692 AAAATCACTCAATAAGTCAGTGG + Intergenic
1074480877 10:113819374-113819396 AAATTTAAGAAATAATTAAGAGG - Intergenic
1075628741 10:123986323-123986345 AAAATTAGGGAAGAAGGGAGAGG - Intergenic
1077946736 11:6908055-6908077 AAATTGAGGCAATAATTAATAGG + Intergenic
1079708772 11:23653846-23653868 AAAATGATGTAATAAATAAGTGG + Intergenic
1079940193 11:26671021-26671043 ACAAGTAGGCAAGAAGTATGTGG + Exonic
1081241126 11:40707862-40707884 AAATTGAGGCAATAATTAATAGG - Intronic
1081364200 11:42214651-42214673 AAAATTAGGCAGAAAGGAAAGGG - Intergenic
1082704460 11:56476749-56476771 AAAATTAGGGAAAAATTAAGAGG - Intergenic
1084072914 11:66748070-66748092 ATAATTAGGGAAAAATTAAGTGG - Intronic
1084207315 11:67603333-67603355 CAAATTAGGGAAGAAGTAGGGGG - Exonic
1085175618 11:74485479-74485501 AAAATAAGTCAATAATTTAGAGG + Intergenic
1085696665 11:78710678-78710700 AAAATTAGGTAATTAATCAGGGG - Intronic
1085721829 11:78919298-78919320 AAAATAACACAATTAGTAAGAGG + Intronic
1086174720 11:83877284-83877306 ACAATTAGCCAATAAGTATACGG - Intronic
1086645880 11:89219682-89219704 AAAAATTGGCCATAAGTATGTGG + Intronic
1087091212 11:94275164-94275186 AACATGAGGCAATAAGAATGAGG - Intergenic
1087241001 11:95779425-95779447 TAATTTTGGCAATAAGAAAGTGG - Intronic
1087963077 11:104376066-104376088 ATGAATAGGCAATAATTAAGTGG - Intergenic
1087984516 11:104660678-104660700 AAAATGAGGCAATAGGAAACTGG + Intergenic
1088074883 11:105835875-105835897 AAAATAAGACAATAATTAATTGG + Intronic
1088605560 11:111527328-111527350 AAAATTAGTCATTATATAAGAGG - Intronic
1089788690 11:120926546-120926568 AAGATTATGCAGTTAGTAAGTGG + Intronic
1089942300 11:122431226-122431248 AAAAATAGGCAAGAAGAAAGGGG - Intergenic
1091425497 12:384603-384625 AAAACTAGCCAATAATAAAGAGG + Intronic
1091964272 12:4724703-4724725 AAACTTGGGCAAAAAGTAAATGG - Intronic
1091982523 12:4877864-4877886 AAAATGAGACAGGAAGTAAGTGG + Intergenic
1092464554 12:8718745-8718767 AAAATTAGGCAGAAAGTACAGGG + Intronic
1092627274 12:10340122-10340144 AAAATGAGGAAATTCGTAAGAGG - Intergenic
1093187415 12:16036830-16036852 AAAATTGGGCAGTAGGTAACTGG + Exonic
1093626697 12:21357942-21357964 AAAATTAAGCTCTAAGTGAGAGG + Intronic
1093644955 12:21574709-21574731 AAAATAAGCTTATAAGTAAGTGG - Intronic
1093856324 12:24107488-24107510 AAAATTAAGTAATGTGTAAGTGG - Intergenic
1094104860 12:26800648-26800670 ATAATTATTGAATAAGTAAGTGG + Intronic
1094303745 12:28994897-28994919 AAAATAAAGCATTCAGTAAGAGG - Intergenic
1094683827 12:32690593-32690615 ATAATTAGGTAACAAGTAACAGG - Intronic
1094740013 12:33278361-33278383 AAAATCACACAATAAATAAGTGG + Intergenic
1095208346 12:39463872-39463894 AAAATAAGGCAAAAAGTCAATGG + Intergenic
1095338464 12:41059691-41059713 CAAATTAGGCACTTACTAAGTGG + Intronic
1095708938 12:45267866-45267888 AATAATAGGCACTAAATAAGTGG - Intronic
1096375402 12:51105428-51105450 AAAAGTAGGCATTAGGGAAGAGG - Intronic
1096516649 12:52159734-52159756 AGAAATAGGCAAGAAGAAAGGGG + Intergenic
1097641418 12:62187713-62187735 AAAATTACCCAATAAGTCAGTGG + Intronic
1097644921 12:62224895-62224917 AAAATTAAAAAATAAGTAATGGG + Intronic
1097900597 12:64869510-64869532 GAACTCAGGCAATAAGAAAGGGG - Intronic
1098278896 12:68842451-68842473 AAAATAAGTCAATAATTTAGAGG - Exonic
1098408589 12:70153940-70153962 AAAATTAGCCAAAAATTAACAGG - Intergenic
1098896747 12:76071312-76071334 AAAATTAAATAATAAGGAAGGGG + Intronic
1099001711 12:77185795-77185817 AACATTAGGCAATAAGTAAAAGG - Intergenic
1099012872 12:77312739-77312761 AAAAATAGGCACAAAGAAAGGGG + Intergenic
1099507270 12:83494766-83494788 AAAGTTAGGCAATAAAGCAGTGG - Intergenic
1099689863 12:85938649-85938671 AAACTTAGGGAAGAAGTATGTGG + Intergenic
1100433481 12:94551209-94551231 AAACTTAGGCAGTAAGGAAGTGG + Intergenic
1100704429 12:97184930-97184952 AAAATTTCTCAATCAGTAAGTGG - Intergenic
1100828436 12:98496249-98496271 AAAAATAGTAAATAAGTAAGTGG + Intronic
1101732580 12:107438958-107438980 AATATTAGGCAATTAGCAAATGG + Intronic
1103401472 12:120646053-120646075 AAAATAAGTAAATAAGTAGGTGG + Intronic
1104109969 12:125695586-125695608 AAAATGAGATAACAAGTAAGCGG - Intergenic
1106175713 13:27329460-27329482 AAAATTATCCAGCAAGTAAGTGG - Intergenic
1106849286 13:33771858-33771880 AAAATAAGGAAATGAGAAAGTGG + Intergenic
1107141900 13:37007846-37007868 AAAATTATGCAATAAGCACTAGG + Intronic
1107487118 13:40839210-40839232 AAATTGAGGCAATAATTAATAGG + Intergenic
1107675702 13:42794507-42794529 AAAATTTGGCAAAAATTTAGGGG + Intergenic
1107829879 13:44365030-44365052 AAGATTAGGAAATAGGTGAGGGG - Intergenic
1108449687 13:50548795-50548817 AAAAACAGGAAATAAGAAAGAGG - Intronic
1108549539 13:51529851-51529873 AAATTGAGGCAATAATTAATAGG + Intergenic
1108566991 13:51709775-51709797 AAACTGAGGCAATAATTAATAGG + Intronic
1108810900 13:54222372-54222394 AAATTGAGGCAATAATTAATAGG + Intergenic
1109141856 13:58722966-58722988 AAAATAAGGCAAGAAAAAAGAGG + Intergenic
1109671472 13:65613928-65613950 AAAATTAGGAATGAAGTAAGAGG - Intergenic
1110261012 13:73485291-73485313 AAAATTAAGGAAGAAGAAAGTGG - Intergenic
1110494826 13:76155217-76155239 AAAATTATGGTATAAGTAATTGG + Intergenic
1110532417 13:76612594-76612616 AAATATAGGCAATAAGTAAATGG + Intergenic
1110727372 13:78840558-78840580 TATATTAGAAAATAAGTAAGGGG - Intergenic
1111329419 13:86744737-86744759 TAAATTAGGAAATAACTCAGTGG + Intergenic
1111473875 13:88722138-88722160 TAAATTAGGGAATAAATTAGAGG - Intergenic
1111769392 13:92577869-92577891 AAAAATAGGCAATAAAGAAGGGG + Intronic
1112648539 13:101364511-101364533 ATATTTAGGCCTTAAGTAAGTGG + Intronic
1113146590 13:107214918-107214940 GAAATTAGGCATCAAATAAGTGG + Intronic
1113232357 13:108226897-108226919 AAAATAAGGCAATCCGTGAGTGG + Intronic
1114129535 14:19774242-19774264 AAAATTAGGAATTATGTAACAGG + Intronic
1114141698 14:19919042-19919064 ACAAGAAGGCAATAACTAAGAGG - Intergenic
1115018391 14:28644738-28644760 AAAATTAGGCTATAATTTAAGGG + Intergenic
1116417471 14:44696398-44696420 AAATTTAGGCAGTAATTAATAGG + Intergenic
1116464704 14:45217777-45217799 TAAATTAGGCATTCAGCAAGAGG - Intronic
1116830068 14:49710966-49710988 AAAATTAGGAAAGAAATAAAAGG - Intronic
1117112886 14:52476433-52476455 AAAATTATGCAAGAAGTAAAGGG + Intronic
1117712247 14:58543253-58543275 AAAAATAGGTAAAAGGTAAGAGG - Intronic
1117759050 14:59006834-59006856 GAAATATGGCAATAAATAAGAGG + Intergenic
1118541635 14:66834212-66834234 AAAAATAATCCATAAGTAAGTGG - Intronic
1118690764 14:68337737-68337759 TAACCTAGGCAATAAGCAAGTGG - Intronic
1119094809 14:71819545-71819567 AAAATTAAGAAAGAAGAAAGAGG - Intergenic
1119117105 14:72034160-72034182 GCAATTAGGCAATAAATAAATGG - Intronic
1119504477 14:75160321-75160343 AAAATTAGGGAATAGGAAACTGG + Intronic
1119733598 14:76966822-76966844 AAAATTATGCTGCAAGTAAGTGG + Intergenic
1119846461 14:77833987-77834009 GAAATTGGGCAATAAGCATGAGG - Intronic
1119873102 14:78033503-78033525 AAAGGTAGGCAAAAAATAAGAGG - Intergenic
1120479195 14:85027601-85027623 CAAATTAGGGAGTCAGTAAGGGG + Intergenic
1121566237 14:94911868-94911890 AAAATGAGGTAATAAGGATGAGG - Intergenic
1124561557 15:30778734-30778756 AAATTGAGGCAATAATTAATAGG + Intergenic
1126662647 15:51047864-51047886 AAAATTAGGCAAAGTGTAAAAGG + Intergenic
1127725064 15:61742090-61742112 CAAATTAGTAAATAAATAAGTGG + Intergenic
1127975414 15:63993432-63993454 AAAATTGGGCAAGAAATAACTGG - Intronic
1128138788 15:65284170-65284192 AATATTAGGCAATCAGTTAATGG - Intronic
1128194717 15:65742204-65742226 GAAAGTAGGAAATAAGGAAGTGG - Intronic
1128562039 15:68675022-68675044 AGACTTAGGCAAGAAGAAAGAGG + Intronic
1130248501 15:82277194-82277216 AAAAGAAGGCAAGAAATAAGGGG + Intronic
1130426727 15:83808946-83808968 AAAAGTAGGCAATAAACCAGTGG + Intronic
1131758663 15:95594929-95594951 AAAATTTGGAAATTATTAAGTGG - Intergenic
1131963294 15:97810892-97810914 AAACCTAGGCAATAAGAAGGTGG + Intergenic
1134866132 16:17608766-17608788 AAAATTAGGGATCAAGCAAGGGG + Intergenic
1135254014 16:20926151-20926173 AGAAATAGGCAAGAAGAAAGGGG + Intergenic
1136425337 16:30166332-30166354 AAAAGTAGGAAATGAGGAAGTGG + Intergenic
1138774800 16:59708324-59708346 AAAAATATTCAATAAATAAGTGG + Intergenic
1142433268 16:90041837-90041859 AAATTTAAGCAATATGTAGGTGG + Intronic
1143843687 17:9755822-9755844 AAAAAAAGGGAATAAGGAAGTGG - Intergenic
1144002293 17:11066470-11066492 AAAATTTAGCAAGAAATAAGAGG + Intergenic
1144354036 17:14427317-14427339 AAAATCTGACAATAAGTTAGTGG - Intergenic
1144711923 17:17406853-17406875 AAAATCATGCAAGAAGAAAGGGG - Intergenic
1145198127 17:20913996-20914018 AAAATTAGGCAATTTGTGAGTGG + Intergenic
1146705680 17:34999158-34999180 AAAATTACACAGTTAGTAAGAGG + Intronic
1146810858 17:35901924-35901946 AGAATTAGGCAGCTAGTAAGTGG - Intergenic
1147441203 17:40448256-40448278 AAAATCAGGCAACAGGAAAGAGG + Intronic
1148269386 17:46251774-46251796 AAAATAAGGGAGTAAGTCAGAGG + Intergenic
1148745432 17:49915454-49915476 AAAATGAGGAAATAAGTACCAGG + Intergenic
1149013870 17:51885922-51885944 ATAGTTAGCCAATAAGTAGGTGG + Intronic
1149069664 17:52524806-52524828 AAAAATAGGAAATAAGAAATAGG - Intergenic
1149437916 17:56649710-56649732 GATATTAGGCAATGTGTAAGTGG - Intergenic
1149503617 17:57174532-57174554 AAAATGAGCCAATAGATAAGGGG - Intergenic
1151472575 17:74327121-74327143 AAAATTAGGGGATGAGGAAGGGG - Intronic
1151769740 17:76152578-76152600 AAAAAAAGACAATAATTAAGCGG + Intronic
1153590714 18:6671772-6671794 AAAATTAACCAATAGGTAGGAGG + Intergenic
1155797965 18:30064449-30064471 AAAAATAGGAAAGAAGAAAGGGG + Intergenic
1155813527 18:30271973-30271995 AAATTAAGGCCATAAGGAAGAGG - Intergenic
1156128411 18:33936894-33936916 ACAAAGAGGCAAAAAGTAAGAGG - Intronic
1156139555 18:34090419-34090441 ACAATTAGGAAATAGGTAAGGGG + Intronic
1156341858 18:36216770-36216792 AAAATTCATCAATAAGTAGGCGG - Intronic
1156536609 18:37870669-37870691 AAGATTATACAACAAGTAAGTGG + Intergenic
1156825545 18:41426420-41426442 AAAATGAGGAGAGAAGTAAGAGG + Intergenic
1157532939 18:48437521-48437543 AAAATTAAGAAATAATTAAATGG + Intergenic
1157790737 18:50528823-50528845 AAAAAGAGGCGAGAAGTAAGAGG - Intergenic
1159238737 18:65712927-65712949 AAAATTAGGTAATAACAATGAGG + Intergenic
1159319387 18:66827405-66827427 AAGATTAGGAAAAAATTAAGTGG + Intergenic
1159474082 18:68895788-68895810 AGAATTAGACAATGAGTAAATGG + Intronic
1159866216 18:73708228-73708250 AAAATTCAGCAATAAGTACAGGG - Intergenic
1161796437 19:6389436-6389458 CAAATCAGGCAGGAAGTAAGTGG - Exonic
1162276198 19:9657094-9657116 AAAATTTGGCTATAAGGATGTGG + Intronic
1162280473 19:9692931-9692953 AAAATTTGGCTATAAGGACGTGG + Intronic
1165909048 19:39212737-39212759 AATATTAAGCAATAAGAAACAGG - Intergenic
925050402 2:810247-810269 AAAATAAGTCATTATGTAAGAGG + Intergenic
926470708 2:13253613-13253635 AAAATTATGCAAATATTAAGTGG - Intergenic
928054729 2:28041484-28041506 AAAATTAGTGAATAAGAAAATGG - Intronic
928380474 2:30813525-30813547 AAAATTCCACAATAAGGAAGTGG - Intronic
928955220 2:36859388-36859410 AAAACTAGGTAATTAGTAAGTGG + Intronic
930295131 2:49544757-49544779 AAATTTGGGCAATAGGTATGTGG - Intergenic
930482205 2:51962749-51962771 AAAATAATACAATAAGTCAGTGG - Intergenic
930690399 2:54356860-54356882 AAATTTAGGCATTAATTAGGTGG - Intronic
931012414 2:57931877-57931899 AAAAATACACAATAAGTAAAAGG - Intronic
931485577 2:62687545-62687567 AAAATTAGGCAAATAATAAGTGG - Intronic
932075862 2:68662115-68662137 AACAAAAAGCAATAAGTAAGAGG - Intergenic
932964163 2:76451138-76451160 AAAATGAGTAAATAAATAAGTGG + Intergenic
933501001 2:83110671-83110693 GAATTTATGCAATTAGTAAGTGG + Intergenic
935637796 2:105263212-105263234 CATATTAGAGAATAAGTAAGAGG - Intergenic
936741335 2:115513111-115513133 AAAATTATGCAATAATAAAAGGG - Intronic
937001094 2:118468253-118468275 AAACTGAGGCTATGAGTAAGTGG - Intergenic
937555236 2:123146025-123146047 TAAATTAGCCAATAAGAAGGTGG + Intergenic
937819365 2:126290541-126290563 ATAAATAGACAAAAAGTAAGAGG + Intergenic
937925723 2:127166115-127166137 AAAACTAGGGAAGAAGTAAATGG - Intergenic
938014657 2:127857636-127857658 AGAATTAGGGAATAAGGATGTGG - Intronic
938277469 2:130038625-130038647 AAAATGGTGCAATAATTAAGTGG + Intergenic
938328439 2:130429428-130429450 AAAATGGTGCAATAATTAAGTGG + Intergenic
938361507 2:130692066-130692088 AAAATGGTGCAATAATTAAGTGG - Intergenic
938437914 2:131298755-131298777 AAAATGGTGCAATAATTAAGTGG - Intronic
938693017 2:133809580-133809602 AAAATCAGGAAATAGGAAAGGGG + Intergenic
940034589 2:149300957-149300979 AAAATTATACAAGAAGTAAAGGG - Intergenic
940181083 2:150933889-150933911 AAAAATAGGCAATAAAAAAGGGG + Intergenic
941121210 2:161532249-161532271 AAAATTATGAAATAAGACAGAGG + Intronic
941767172 2:169310852-169310874 AAATTGAGGCAATAATTAAGAGG - Intronic
942627377 2:177916505-177916527 AAAATTAGACTATAAGATAGAGG - Intronic
942750707 2:179283670-179283692 AAAATTAAGCAAGCAATAAGAGG + Intergenic
942969094 2:181935390-181935412 AAAATTAGTAAATTAGTAAATGG - Intergenic
943272319 2:185822224-185822246 AAAATTAGGCAAGAAAAAGGGGG + Intronic
943525026 2:189005686-189005708 TAAATTAGGAAAAAAGTTAGTGG + Intronic
943961333 2:194266743-194266765 TAAATAAGGCAATGGGTAAGTGG - Intergenic
944006409 2:194913440-194913462 GGAATTTGGAAATAAGTAAGGGG - Intergenic
944379519 2:199092085-199092107 AGAAATAGGCAAGAAGAAAGGGG + Intergenic
944805442 2:203276586-203276608 AAAATTAGGGTATAAGGGAGAGG + Intronic
945392812 2:209285188-209285210 AAACTGAGGCAATAATTAATAGG + Intergenic
945717467 2:213377663-213377685 AAAGTAAGGGAAAAAGTAAGAGG - Intronic
946779459 2:223178055-223178077 ATATTTAGGAAATAAGTCAGAGG + Intronic
946794363 2:223333992-223334014 AAATTGAGGCAATAATTAATAGG + Intergenic
947022774 2:225700244-225700266 AAAATAAGGAAAAAGGTAAGTGG + Intergenic
948325128 2:237111639-237111661 AAAATAAGGCAAGAAGTGAGGGG + Intergenic
1170388301 20:15844538-15844560 AAGATTATGCAACTAGTAAGTGG + Intronic
1173264746 20:41469002-41469024 AAAATTAGGTAAGAAATAGGGGG + Intronic
1173477866 20:43374945-43374967 AAAATTAGGAAATAAGATAATGG - Intergenic
1177080440 21:16632719-16632741 AAATGTAGGGAATAAGTTAGAGG + Intergenic
1177136987 21:17315314-17315336 AAAATGTGGCATTATGTAAGAGG + Intergenic
1177206872 21:18020511-18020533 AAAATTAGGCCAAAAGAAAAAGG - Intronic
1177486254 21:21760350-21760372 AGAAGTATGCACTAAGTAAGAGG + Intergenic
1177879222 21:26671951-26671973 AAAGTTAGTGAATAAGTATGGGG - Intergenic
1178272641 21:31205971-31205993 AAAATTAATAAATAAGTAAAAGG + Intronic
1179555294 21:42171388-42171410 AAAATTTGGCAAGAGGAAAGAGG + Intergenic
1182153156 22:28045021-28045043 AAAATAAGACAACAAGTAATGGG - Intronic
1183323370 22:37178353-37178375 AACGTTAGGCAATGAGGAAGGGG - Intergenic
1183589122 22:38769724-38769746 ATCATCAGGCAAGAAGTAAGTGG + Intronic
951810874 3:26698307-26698329 GAAATTATGCAATGAGTTAGTGG + Intronic
952187390 3:30984629-30984651 AAAATTATGGAAGAAGTTAGAGG - Intergenic
953812313 3:46123835-46123857 AAAATTGGGCAAGCATTAAGAGG + Intergenic
954282556 3:49592784-49592806 AAAATTGGGCAAAATGTAAAAGG - Intronic
956277834 3:67522201-67522223 AAAATAAAGCAAAAATTAAGTGG - Intronic
956540020 3:70326286-70326308 AAAATCAGACAATTAATAAGTGG - Intergenic
956690009 3:71867735-71867757 AAAAATAGGCTAAAAGTAAAAGG + Intergenic
957166796 3:76684522-76684544 AAAATAAGGAACTAAGTAATGGG - Intronic
957558510 3:81791814-81791836 AAAATTTGGCAAGTAGTAATAGG - Intergenic
957886383 3:86293822-86293844 TAAATTAGTCAATAATTGAGAGG - Intergenic
958574603 3:95931966-95931988 AAAATAAGTAAATAAGTAATAGG + Intergenic
959720906 3:109487688-109487710 GTAATTAGGCAATGAGTAAGTGG - Intergenic
960670169 3:120148016-120148038 AGAATTAGGCAAATAATAAGGGG - Intergenic
960776727 3:121264420-121264442 AGAATTAGGAAAAAAGAAAGGGG + Intronic
962223285 3:133582479-133582501 ATACTTAGGAAAAAAGTAAGTGG - Intronic
963029438 3:140953334-140953356 AAAATTAGACAAAAAGTAGTAGG - Intronic
964261668 3:154846220-154846242 AAAAGAAGGCAAAAAGCAAGAGG + Intergenic
964675640 3:159276910-159276932 CAAATTAGGCAAGATGGAAGTGG - Intronic
965150110 3:164962432-164962454 AAATTCAGGCAATGAGAAAGTGG - Intergenic
965243483 3:166232999-166233021 AAAATTAAGCAATAAACAAAAGG - Intergenic
965270533 3:166612516-166612538 AACATTATGTAATAAGGAAGAGG - Intergenic
965446796 3:168782960-168782982 AAAATTCTGAAAGAAGTAAGAGG + Intergenic
965619101 3:170624548-170624570 AAAATGAGGAAAGAAGTAAGAGG + Intronic
965899815 3:173625034-173625056 AAAATCAGGGAAAAGGTAAGTGG - Intronic
966837334 3:184059258-184059280 AAAATTAGACAACAAATCAGAGG + Intronic
967725262 3:192856433-192856455 GAAATTAGGCAATAAGCACCAGG + Intronic
968145578 3:196295482-196295504 AAAATTAAGCAAAAATAAAGAGG - Intronic
968374267 4:25030-25052 TTAATTGGGCAATAAGTGAGAGG + Intergenic
971196447 4:24474970-24474992 AAAATCAGGGAATCAGTGAGTGG - Intergenic
971806659 4:31367049-31367071 AAAATCTGGGAATAAGAAAGGGG + Intergenic
971865446 4:32164746-32164768 AAAGTGAGGCAAAAAGGAAGAGG - Intergenic
971939864 4:33200428-33200450 AAAAATAGGCCAAAACTAAGGGG - Intergenic
973572134 4:52251462-52251484 AAAATTAGACCCTAAGAAAGTGG - Intergenic
974492244 4:62581423-62581445 AAAATCAGACAGTAACTAAGGGG - Intergenic
974527740 4:63065839-63065861 AAAATTATGCAATAGGGAAAAGG - Intergenic
974953518 4:68609663-68609685 AAATTGAGGCAATAATTAATAGG - Intronic
976660361 4:87534357-87534379 AAAATTAGGGCAAAAATAAGAGG + Intergenic
977179211 4:93853591-93853613 AAAATATGGCCATAAGGAAGTGG - Intergenic
977405626 4:96594701-96594723 AAAATTAGAGAATCAGTCAGGGG - Intergenic
977676475 4:99753707-99753729 TAAATTAGTCAATAATTAAAAGG + Intergenic
977779570 4:100964924-100964946 AAAGTTAAGCAATAAATTAGTGG + Intergenic
978150608 4:105429563-105429585 AAAATTAGGCACCAAGAAAGTGG + Intronic
979245005 4:118492623-118492645 AAAATTTTGCAATAATTAATGGG + Intergenic
979600315 4:122580417-122580439 AAAGTTAGACAATAAGTTATTGG + Intergenic
979637390 4:122973164-122973186 TCAAATAGGCATTAAGTAAGAGG - Intronic
979926940 4:126579728-126579750 AAAATTAGCAAATATGTATGAGG + Intergenic
980067705 4:128208368-128208390 AAAAATAGGAAAGAAGTAAAAGG + Intronic
980137711 4:128875691-128875713 TATATTAGGCATTTAGTAAGTGG + Intronic
980262601 4:130471636-130471658 AAAAATAGGCAATAGATTAGAGG + Intergenic
980310204 4:131118230-131118252 ACAATTAAGAAATAAGTAACTGG - Intergenic
980488720 4:133496315-133496337 TAAAGTAGACAATAAGTAATGGG + Intergenic
980582223 4:134770189-134770211 AAATTTGGGAAATAAGTATGTGG - Intergenic
981791286 4:148539872-148539894 AAAATTAGGGAGAAAGCAAGTGG - Intergenic
981984952 4:150842739-150842761 AAGATTATACAATTAGTAAGAGG - Intronic
982162729 4:152586300-152586322 AAAAGGAGGCAATAAGTAGGAGG - Intergenic
982162737 4:152586354-152586376 AAAAGGAGGCAAAAAGTAGGAGG - Intergenic
982404871 4:155008400-155008422 TAAATTCTGCAACAAGTAAGTGG - Intergenic
982645827 4:158024297-158024319 AAAATTTGAAAATAAGTAAATGG + Intergenic
982883527 4:160749138-160749160 AAATTGAGGCAATAATTAATAGG - Intergenic
983305915 4:165986615-165986637 AAAATATGGCAATAAATAAATGG + Intronic
984215148 4:176902687-176902709 AAAATTAATCAATAAGAAAATGG + Intergenic
984308480 4:178025777-178025799 AAAATGTGTCAATAAATAAGAGG + Intergenic
985128624 4:186720022-186720044 GAAATTAGGAAATTAGTTAGAGG - Intronic
985460463 4:190101233-190101255 TTAATTGGGCAATAAGTGAGAGG - Intergenic
986464311 5:8006127-8006149 AGAAATAGGCAAGAAGTAGGGGG - Intergenic
987754369 5:22081892-22081914 AAAATTAGTGAATAAGTGATTGG + Intronic
987962906 5:24833132-24833154 ATCATTAAGGAATAAGTAAGTGG + Intergenic
988229328 5:28453813-28453835 AAATTAAGGAAATAATTAAGAGG + Intergenic
988280243 5:29135906-29135928 GAAATTAGGCAATAAGGAAAGGG - Intergenic
988614247 5:32758253-32758275 AAATTGAGGCAATAATTAATAGG - Intronic
990481562 5:56216105-56216127 ATAATTAGGAAATAAGTATAAGG + Intronic
990765036 5:59173040-59173062 AAAATTAGACAACTACTAAGAGG + Intronic
990800167 5:59592861-59592883 AAAATTACACAAAAAGTAAAAGG - Intronic
990963758 5:61422414-61422436 AAAAATAGACACTTAGTAAGTGG - Intronic
992507489 5:77401639-77401661 CAAAGTAGGCACTCAGTAAGTGG + Intronic
994123094 5:96139389-96139411 AAGATTAGGTAACTAGTAAGTGG - Intergenic
994230264 5:97303625-97303647 AAACTGAGGCAATAATTAATAGG - Intergenic
994377651 5:99033318-99033340 TAAATAAGCGAATAAGTAAGAGG - Intergenic
994736315 5:103560998-103561020 ATGATTAGGCAATATTTAAGAGG - Intronic
995463619 5:112428294-112428316 AAATTGAGGCAATAATTAATAGG - Intergenic
995665131 5:114533304-114533326 AAATTGAGGCAATAATTAATAGG - Intergenic
995788504 5:115857785-115857807 AAAATTATGAAATAACTATGAGG - Intronic
995988225 5:118206746-118206768 AAAACAAGGCAATAAGCAAAAGG + Intergenic
996980791 5:129491367-129491389 AAAATTAGACAATTAATTAGAGG - Intronic
998632448 5:143914737-143914759 AAAATAAGGCAACCAATAAGGGG + Intergenic
998644474 5:144047049-144047071 AAAGTTACACAATTAGTAAGTGG + Intergenic
998661138 5:144239068-144239090 AAAATCACACAACAAGTAAGTGG - Intronic
998677402 5:144425182-144425204 AGAAATAGGCAAGAAGAAAGAGG + Intronic
998763531 5:145458879-145458901 GAAATAAGTCAATAAGTAATGGG + Intergenic
1000176483 5:158760748-158760770 AAAATGAAGCAATAATTCAGGGG - Intronic
1000779777 5:165465779-165465801 AAAATGATGCAAGAAGTGAGGGG + Intergenic
1000798041 5:165690049-165690071 AAATTGAGGCAATAATTAATAGG - Intergenic
1001215792 5:169854600-169854622 AAAATTATGCAGAAAGTCAGGGG + Intronic
1001465030 5:171956676-171956698 AAAATTAGGCACTGAGTTAGAGG - Intronic
1002382110 5:178838619-178838641 AGAATGAGGGAATAAGGAAGGGG + Intergenic
1002391668 5:178918113-178918135 AAAGGGAGACAATAAGTAAGTGG - Intronic
1002648615 5:180674646-180674668 AGAATGAGGGAATAAGGAAGGGG - Intergenic
1003888494 6:10542626-10542648 AAAACATGGCAATAAGTAAAAGG - Intronic
1004056367 6:12142874-12142896 AAATTGAGGCAATAATTAATAGG + Intronic
1004460923 6:15835180-15835202 AAAATTTGGCAACAACTAATGGG + Intergenic
1005079471 6:21942305-21942327 AAAATCATGCAATAAATAAAAGG - Intergenic
1006421545 6:33937208-33937230 CATATTAGGCAGTAAGTAACAGG - Intergenic
1008866041 6:56210813-56210835 AAAATTATTCAATAAATAAATGG + Intronic
1009921824 6:70071871-70071893 AAAATTTGGAACAAAGTAAGTGG + Intronic
1010264902 6:73855218-73855240 AAAATTAGGCAACAATTTGGGGG - Intergenic
1010272471 6:73929700-73929722 AAGGTAAGGCAATAAGCAAGTGG - Intergenic
1010724915 6:79322303-79322325 AAATTGAGGCAATAATTAATAGG - Intergenic
1011450902 6:87490690-87490712 AAAACTAGGCAAAAAATATGAGG + Intronic
1011546605 6:88488056-88488078 AAATTTAGGAAATAAAGAAGGGG + Intergenic
1012121746 6:95376941-95376963 TATATTATGTAATAAGTAAGTGG + Intergenic
1012673095 6:102080752-102080774 AAAATAAGTCAATAAGAAACTGG - Intergenic
1013223653 6:108103135-108103157 GCAATTAAGCAATATGTAAGTGG + Intronic
1013229649 6:108150513-108150535 AAAAGAAGGCAAAAAGGAAGAGG + Intronic
1014593265 6:123299153-123299175 AAAATGAGACAATAAGAAATGGG + Intronic
1014873741 6:126629458-126629480 AAAATTATACTATAAATAAGAGG + Intergenic
1015179327 6:130345077-130345099 AAGGTGGGGCAATAAGTAAGTGG + Intronic
1016062323 6:139643753-139643775 AAAATCAAGAAACAAGTAAGTGG - Intergenic
1016430711 6:143982401-143982423 AAGATTAGGCCAGAAGTAATGGG + Intronic
1016707706 6:147131807-147131829 AAAACAAGGCAACAAGTGAGAGG + Intergenic
1017564867 6:155672732-155672754 TAAATTAGGAATTAAGTAGGGGG - Intergenic
1017612932 6:156210636-156210658 AAAATCAGGCTATAGGTATGTGG + Intergenic
1018500128 6:164399689-164399711 AATATGAGGCAAAAATTAAGAGG + Intergenic
1018769946 6:166961793-166961815 AAAATAAACAAATAAGTAAGTGG - Intergenic
1020378771 7:7518585-7518607 AAAATTAGGCAATAAGTAAGAGG - Intronic
1020933767 7:14433486-14433508 AAAAATGGGTAATAAGAAAGCGG + Intronic
1021198719 7:17701974-17701996 AAAATTAGACTAGAAGTAAATGG + Intergenic
1021424253 7:20481651-20481673 AAAATTAGGAAAGAAGGAAGGGG - Intergenic
1021642970 7:22758057-22758079 AAACTTAGGCACTGTGTAAGGGG - Intergenic
1022130437 7:27399988-27400010 AAAAATAGGCAGTTATTAAGGGG - Intergenic
1022900189 7:34801057-34801079 AAATTGAGGCAATAATTAATAGG + Intronic
1022901724 7:34817407-34817429 AAATTGAGGCAATAATTAATAGG + Intronic
1023412265 7:39899959-39899981 AAAATTAGGCACCAAGAAGGGGG + Intergenic
1023509621 7:40937763-40937785 AAAAATAGGCTAAAAGTAAAAGG - Intergenic
1024298840 7:47869391-47869413 AAAATTAGGTTGTAAGTAAAAGG + Intronic
1024406265 7:48984923-48984945 AAAATTAAGAAATATGTATGAGG - Intergenic
1024457851 7:49629526-49629548 AAAATGAGGCAATTTGTAACAGG - Intergenic
1024460345 7:49653217-49653239 AAATTGAGGCAATAATTAATAGG + Intergenic
1024890344 7:54194204-54194226 AAAAATAAGCAATAGGTAAGGGG + Intergenic
1026556122 7:71410230-71410252 AAAATCAGGAAAGAAGTGAGGGG - Intronic
1027209910 7:76137538-76137560 AAAATAAATAAATAAGTAAGAGG + Intergenic
1027963376 7:84975118-84975140 ATAAGTAGGCAATAATTAAAAGG - Intergenic
1028071481 7:86456425-86456447 AAAATTAGGCAAAACCAAAGAGG + Intergenic
1028410058 7:90521037-90521059 AAAAATAGGAAATATGTCAGTGG + Intronic
1028867821 7:95734088-95734110 AAAAGTAGACAATATGTAAGAGG + Intergenic
1029796289 7:102897993-102898015 AAAAATAGGGAGTAAGTATGGGG + Intronic
1029917717 7:104229576-104229598 AAAATTAGGAATGAAGAAAGAGG + Intergenic
1030287171 7:107838485-107838507 AAAAATAGCCAAAAAGAAAGGGG + Intergenic
1030319708 7:108152437-108152459 AAAAGTAGGAGTTAAGTAAGGGG + Intronic
1030508329 7:110452832-110452854 AATATTTGGCAACAAGTAAGCGG - Intergenic
1030586310 7:111423366-111423388 AAATTGAGGCAATAATTAATAGG - Intronic
1030933754 7:115558165-115558187 AAAAAAAAGCAATAAGCAAGAGG - Intergenic
1030988844 7:116275262-116275284 AAAATAACGCAATATTTAAGGGG + Intergenic
1031349272 7:120708975-120708997 TAATTAAGGCCATAAGTAAGTGG + Intronic
1031452799 7:121942840-121942862 AAAATTAGGAAATTGGAAAGTGG - Intronic
1032130935 7:129226673-129226695 AAATTTAGGTGATAAGTCAGAGG + Intronic
1032959407 7:137014408-137014430 AAAATTAGTAAATTAGTGAGAGG - Intronic
1033034761 7:137863874-137863896 AAAATTAGGCAGGTAGGAAGGGG - Intergenic
1033296911 7:140147167-140147189 AATGTTAGGCCATAAGTCAGTGG - Intronic
1034175119 7:149093624-149093646 AATATTGGGCAAAAAGCAAGTGG + Intergenic
1034215469 7:149402248-149402270 GAAATCAGACAATAAGGAAGTGG - Intergenic
1034851024 7:154493950-154493972 AAGATAAGCCAAGAAGTAAGAGG + Intronic
1034870623 7:154680056-154680078 AGAATTAGGAAATAATTATGGGG + Intronic
1036172329 8:6500394-6500416 AAGATTAAGTAATAATTAAGTGG + Exonic
1037086967 8:14864229-14864251 AAAAATAGGAAACATGTAAGTGG - Intronic
1037549613 8:19957456-19957478 AAAATCAGGCAATGCGTATGAGG + Intronic
1038380587 8:27089515-27089537 AGAAATAGGCAAGAAGAAAGGGG + Intergenic
1038844698 8:31217604-31217626 TAAATAAGGGAGTAAGTAAGGGG + Intergenic
1038905989 8:31903562-31903584 AAAATTACTCAATAACTTAGAGG - Intronic
1039647709 8:39305567-39305589 AGAAATAGGCAAGAAGAAAGTGG + Intergenic
1039651102 8:39340197-39340219 AGAAATAGGCAAGAAGGAAGGGG + Intergenic
1040738279 8:50538381-50538403 AAAATTAAGCAGAAAGGAAGCGG - Intronic
1040741076 8:50576674-50576696 ATACTTAGGAATTAAGTAAGAGG - Intronic
1040774548 8:51024174-51024196 AAAATCAGACAATAAATCAGTGG + Intergenic
1040924681 8:52666732-52666754 AAAATTAAGAAATGAGCAAGTGG + Intronic
1041311617 8:56523234-56523256 GAACTTAGGCAAGAAGTAAATGG - Intergenic
1041396119 8:57393455-57393477 AAGATCAGGGAATAGGTAAGTGG + Intergenic
1043134953 8:76510193-76510215 AAAATTGGGCAAGAACCAAGAGG - Intergenic
1043544872 8:81303814-81303836 AAAATTAGGCTATTAGTTACTGG + Intergenic
1043705712 8:83347466-83347488 AAAATTTGACAATAAGTAAGAGG + Intergenic
1043794151 8:84514333-84514355 AAAATTTAACAATAGGTAAGTGG + Intronic
1043794705 8:84521885-84521907 ACAATTAGGTACTAAGAAAGAGG - Intronic
1044339336 8:91028787-91028809 AAATTTAGATAATAAGCAAGTGG - Intronic
1045568621 8:103346987-103347009 AAAATGAGTAAAAAAGTAAGAGG + Intergenic
1045850688 8:106695214-106695236 AAGTGTAGGGAATAAGTAAGTGG - Intronic
1046540687 8:115578176-115578198 AAAATTAGGAGAAAAGCAAGTGG - Intronic
1047006434 8:120624866-120624888 AGAAATAGGCAAGAAGAAAGGGG + Intronic
1048058726 8:130895088-130895110 AAATTGAGGAAATAAGTCAGGGG + Intronic
1048479729 8:134777799-134777821 ACAATTAGGCTATAAGGAAAAGG + Intergenic
1050710737 9:8459902-8459924 AAAATTAAGGATTAAGGAAGGGG - Intronic
1050920288 9:11192433-11192455 AAAATAATCCAATAAATAAGTGG - Intergenic
1050954643 9:11639313-11639335 AAATTGAGGCAATAATTAAGAGG - Intergenic
1050991124 9:12153548-12153570 AAAGTAATGCAATTAGTAAGTGG - Intergenic
1051561995 9:18452665-18452687 AGAAATAGGCAAGAAGAAAGGGG + Intergenic
1052460914 9:28761837-28761859 AAAATTAGTCCTTATGTAAGAGG - Intergenic
1052550573 9:29942245-29942267 AAAATTAAGAAATAAGTTAGAGG - Intergenic
1052676309 9:31629655-31629677 AAAATTAGGAAACAGGTAATTGG + Intergenic
1053650047 9:40159073-40159095 AAAATTAGGTAATATTTAACTGG - Intergenic
1053755694 9:41304854-41304876 AAAATTAGGTAATATTTAACTGG + Intergenic
1054330550 9:63750828-63750850 AAAATTAGGTAATATTTAACTGG - Intergenic
1054534534 9:66217130-66217152 AAAATTAGGTAATATTTAACTGG + Intergenic
1054900270 9:70361475-70361497 TAAAATAGGTAATATGTAAGTGG - Intergenic
1055679284 9:78698281-78698303 AAAATTAGACAACTAGGAAGAGG - Intergenic
1058012318 9:99992007-99992029 AAATTGAGGCAATAATTAACAGG + Intronic
1058220063 9:102288451-102288473 AAAAGAAGGCAAGAAGTAAGAGG - Intergenic
1058495190 9:105551018-105551040 AAAATAAGTCAAATAGTAAGTGG + Intronic
1058549701 9:106101171-106101193 AAAATAAGGCAAGAAATATGAGG - Intergenic
1058591959 9:106574858-106574880 AAAATTAGTCAGTCAGTCAGTGG + Intergenic
1058607393 9:106737239-106737261 AAAATTTGGCAAAAATTAATAGG + Intergenic
1058838389 9:108880251-108880273 AAAATTCAGCAAAAAGAAAGAGG + Intronic
1058992523 9:110268401-110268423 AAAATTAGGAAATATTTAATAGG + Intergenic
1059047515 9:110885693-110885715 AGAATTAGGAAAAAAGGAAGAGG - Intronic
1059911258 9:119046661-119046683 AAAAACAGGAAAAAAGTAAGAGG - Intergenic
1059938953 9:119339013-119339035 AAAATGAGGCACTAAATGAGAGG + Intronic
1202797938 9_KI270719v1_random:143748-143770 AAAATTAGGTAATATTTAACTGG - Intergenic
1187861756 X:23689892-23689914 AAAATTAGTAAATAAATAGGAGG + Intergenic
1187944956 X:24416804-24416826 AGAAATAGGCAAGAAGAAAGGGG - Intergenic
1188301610 X:28511110-28511132 AAAACTAGCCAAAAAGAAAGAGG + Intergenic
1189069186 X:37846643-37846665 AAACGTAGGAAATAAGCAAGAGG + Intronic
1190532906 X:51397522-51397544 AAAGTCATGCACTAAGTAAGTGG + Intergenic
1192035535 X:67558933-67558955 AAGATTAGAGAACAAGTAAGTGG + Intronic
1192918744 X:75683168-75683190 AAATTCAGGCAATAATTAATAGG - Intergenic
1192923117 X:75728892-75728914 AGAAATAGGCCAAAAGTAAGGGG + Intergenic
1193449648 X:81649858-81649880 AAAAATAGGCAAGAAGAAAGAGG - Intergenic
1194173967 X:90624429-90624451 AGAAATAGAAAATAAGTAAGGGG + Intergenic
1195866490 X:109438499-109438521 AGAAGTAGGCAAGAAGAAAGAGG + Intronic
1196723453 X:118875833-118875855 AGAAATAGGCAAGAAGAAAGGGG - Intergenic
1197473340 X:126890471-126890493 AAAAGTAGGCCAAAAGAAAGGGG + Intergenic
1197536370 X:127693001-127693023 AAAACTAGTCAATAAAAAAGAGG - Intergenic
1198638034 X:138721970-138721992 GAAATAAGGCAATATGAAAGAGG - Intronic
1199438527 X:147841926-147841948 AAACTTATGCAAGAAGGAAGAGG - Intergenic
1200520184 Y:4202130-4202152 AGAAATAGAAAATAAGTAAGGGG + Intergenic
1201602330 Y:15744991-15745013 AAATTGAGGCAATAATTAATAGG - Intergenic
1202040495 Y:20677951-20677973 AAATTGAGGCAATAATTAAGTGG + Intergenic