ID: 1020381703

View in Genome Browser
Species Human (GRCh38)
Location 7:7554932-7554954
Sequence GGCAGCACAGCCTGAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020381700_1020381703 17 Left 1020381700 7:7554892-7554914 CCTTTGCACTACAAGAGCAAAAT No data
Right 1020381703 7:7554932-7554954 GGCAGCACAGCCTGAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020381703 Original CRISPR GGCAGCACAGCCTGAGGAGC TGG Intergenic
No off target data available for this crispr