ID: 1020382820

View in Genome Browser
Species Human (GRCh38)
Location 7:7565670-7565692
Sequence GAGTGGGCATGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020382820_1020382823 -10 Left 1020382820 7:7565670-7565692 CCCACTTCTCTCCATGCCCACTC No data
Right 1020382823 7:7565683-7565705 ATGCCCACTCTCCGTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020382820 Original CRISPR GAGTGGGCATGGAGAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr