ID: 1020388013

View in Genome Browser
Species Human (GRCh38)
Location 7:7628865-7628887
Sequence GGCTCTCCACTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020388013_1020388017 24 Left 1020388013 7:7628865-7628887 CCTGCTCTAGTCAGTGGAGAGCC No data
Right 1020388017 7:7628912-7628934 AAAATACTTTTTTTTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020388013 Original CRISPR GGCTCTCCACTGACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr