ID: 1020388744

View in Genome Browser
Species Human (GRCh38)
Location 7:7635724-7635746
Sequence ATCTCTCTCTAGCACCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020388744_1020388745 -1 Left 1020388744 7:7635724-7635746 CCAACATGGTGCTAGAGAGAGAT No data
Right 1020388745 7:7635746-7635768 TTCCATACTAAAGATTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020388744 Original CRISPR ATCTCTCTCTAGCACCATGT TGG (reversed) Intergenic
No off target data available for this crispr