ID: 1020388850

View in Genome Browser
Species Human (GRCh38)
Location 7:7636596-7636618
Sequence TCCTTAACACAGCTGGCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020388850 Original CRISPR TCCTTAACACAGCTGGCCCA AGG Exonic
900098983 1:952935-952957 TGCTTCACACAGCTTCCCCAGGG - Intronic
902179103 1:14674347-14674369 TCCTCAACAGAGCTGGTTCATGG - Intronic
903359458 1:22767675-22767697 TCCTTCCCACCACTGGCCCAGGG + Intronic
904868306 1:33600162-33600184 GGTTTTACACAGCTGGCCCAAGG + Intronic
907600726 1:55766634-55766656 GTCTTAACTCAGCTGGGCCATGG - Intergenic
908986032 1:70023210-70023232 TGCTGATCACACCTGGCCCATGG - Exonic
909062229 1:70892393-70892415 TATTTAACACAGCTGGCACCAGG + Intronic
915036657 1:152933345-152933367 TTGTTCTCACAGCTGGCCCATGG - Intergenic
920841704 1:209560903-209560925 TCCTAAACACTCCTGGGCCAGGG - Intergenic
921293255 1:213678308-213678330 TTAAGAACACAGCTGGCCCAAGG + Intergenic
923833614 1:237585028-237585050 TACTTAAAACAGCAGGGCCAAGG - Intronic
1063520226 10:6734640-6734662 TCCTCTAGACAGCTGGCTCAGGG - Intergenic
1066236848 10:33493411-33493433 TCCAGAACACATCTGGACCAAGG + Intergenic
1067109250 10:43387808-43387830 TCCTCAACAGAGCAGGACCAGGG + Exonic
1067190234 10:44062410-44062432 TCCTTAGCACAGCTTACCCCAGG - Intergenic
1067203166 10:44192472-44192494 TCCTTCCCACAGGTGGCACATGG - Intergenic
1067407161 10:46033610-46033632 TCCTGAACAGAGCTGGCACTGGG - Intronic
1068640054 10:59393595-59393617 ACCTAAGCACTGCTGGCCCAAGG + Intergenic
1069198313 10:65581810-65581832 TCTGTAACACAGCTGGGCAAGGG + Intergenic
1070453572 10:76586640-76586662 TAATTAAAACTGCTGGCCCAAGG - Intergenic
1071110496 10:82149958-82149980 TTCCTGGCACAGCTGGCCCAGGG - Intronic
1071140838 10:82507576-82507598 TGCTAAACACAGCAGACCCAAGG + Intronic
1071765899 10:88665031-88665053 TCCCTATAAAAGCTGGCCCAGGG + Intronic
1072756280 10:98023292-98023314 TCCTTCCCAGAGCTGGCACAAGG - Intronic
1073302498 10:102479617-102479639 TCCTTAACCAAGCAGGTCCAAGG + Exonic
1074469457 10:113714228-113714250 ACCTAAACAGAGGTGGCCCAGGG + Intronic
1074781557 10:116806012-116806034 TCCATCACAGAGGTGGCCCAAGG - Intergenic
1079079347 11:17403113-17403135 ACCTTGAGACAGCTGGCCAAAGG + Intronic
1080387716 11:31819523-31819545 GCCTTAACACAGGATGCCCAGGG - Intronic
1081693469 11:45094000-45094022 TCCTCAAGACAGCTGGAACAAGG - Intergenic
1081757303 11:45553936-45553958 TCCTTGTCACAGCTGGGGCAAGG - Intergenic
1081764553 11:45600489-45600511 TCCTCAACACAGATACCCCAAGG + Intergenic
1083774717 11:64888761-64888783 TCCTTTACCCAGCAGGCCCTGGG - Intergenic
1084199442 11:67545611-67545633 TCCCAAACACAGCTGGCCAGGGG + Intergenic
1087882522 11:103434744-103434766 TCCTTCACACAGCTCACTCATGG + Intronic
1088076494 11:105855238-105855260 TGCTTAACACTGCTTTCCCAAGG + Intronic
1091794995 12:3293160-3293182 TCCTGGAACCAGCTGGCCCATGG - Intergenic
1094497326 12:30996409-30996431 TCCTGGAAGCAGCTGGCCCATGG + Exonic
1096240544 12:49957635-49957657 TCCATAGCACATATGGCCCAGGG - Exonic
1100044769 12:90366332-90366354 ATTCTAACACAGCTGGCCCATGG + Intergenic
1100063552 12:90611541-90611563 TCCTTGTCACAGCTTGCTCATGG - Intergenic
1100242622 12:92725104-92725126 TCCTTAACACAGATAATCCATGG + Intronic
1105468762 13:20672624-20672646 TCCACAACACACCTGGCCCCAGG - Intronic
1105615580 13:22009148-22009170 TACTTAAGACATCTGGCCCAAGG + Intergenic
1112002382 13:95222706-95222728 TCATTAACACACCTGGCATACGG + Intronic
1112827678 13:103410890-103410912 AACCTAAGACAGCTGGCCCAAGG - Intergenic
1119877305 14:78071787-78071809 CCCTAAACACATCTGGCCCAAGG - Intergenic
1124696186 15:31866531-31866553 GCCTTAACACAGATGCCACAAGG - Intronic
1129498926 15:76017253-76017275 TCCTAAACACAGCACGCCAATGG + Intronic
1135865999 16:26102533-26102555 TCCTTGAAACAGCTGTCCCTTGG + Intronic
1136028090 16:27482783-27482805 TTCTTAACAAAACAGGCCCAAGG + Intronic
1136567111 16:31077123-31077145 TCCTTGAAACAGATGGCACAGGG - Exonic
1139263799 16:65621321-65621343 TCCCCACCACAGCTGACCCAGGG + Intergenic
1141612820 16:85192770-85192792 CCCTTCCAACAGCTGGCCCAGGG - Intergenic
1144639892 17:16931445-16931467 ACCTGAACCAAGCTGGCCCAGGG - Intronic
1150340567 17:64363346-64363368 TCCTTCACACATCTGGACCAAGG - Exonic
1151136891 17:71955456-71955478 TCCCTAACACAAGTGGCCCACGG + Intergenic
1152312749 17:79560844-79560866 TCCTTTTCTCAGCTGCCCCAGGG + Intergenic
1153014045 18:567240-567262 TCAACAACACTGCTGGCCCATGG + Intergenic
1158449788 18:57554030-57554052 TCCTTAAACCAGGTGCCCCAGGG - Intronic
1164643123 19:29840880-29840902 TCCATAAGACAGCTGGCCCAGGG + Intergenic
930405217 2:50946112-50946134 TCCTTAACATGGCAGCCCCATGG - Intronic
931150843 2:59571521-59571543 TCCTTAACAGATCTGGCTCTTGG + Intergenic
931241282 2:60454493-60454515 TCCTGAACACACCAGGCCCAGGG + Intronic
931930243 2:67124746-67124768 TGCATATCACAGCTGGGCCAGGG + Intergenic
932973113 2:76570067-76570089 TCCTGACCACTGCTGTCCCATGG - Intergenic
935526825 2:104181069-104181091 TCCTTTACAGAGCAGGCCCCTGG + Intergenic
936172261 2:110186432-110186454 TCCTTAACCAAGCAGGTCCAAGG - Intronic
937562926 2:123246960-123246982 TCCTAAACACAGCACACCCATGG - Intergenic
943764082 2:191641756-191641778 TCCTTAACACAACCGGCCATTGG + Intergenic
945624573 2:212186248-212186270 TGCTTAACAAAGATGGCACAAGG - Intronic
946869610 2:224073978-224074000 TCCTCAGCATACCTGGCCCAAGG - Intergenic
948930602 2:241129360-241129382 CCCCAAACACATCTGGCCCAAGG - Intronic
949000736 2:241611285-241611307 TCCTGCAAACAGCAGGCCCAGGG + Intronic
1169623666 20:7538515-7538537 TCCTAAACACAACTGACCCCTGG - Intergenic
1173639677 20:44592086-44592108 TGCTTATCACATCTGGCACATGG - Intronic
1174833541 20:53835498-53835520 TCCTTGACACAGCCTCCCCAAGG - Intergenic
1175858273 20:62134557-62134579 TCTGTAACCCAGCTGGCCCCTGG + Exonic
1176107742 20:63397563-63397585 TTCTTTCCACAGCTGTCCCATGG + Intergenic
1178128792 21:29545990-29546012 TCCTTATCCCAGCTGACCCTTGG - Intronic
1179279639 21:39923690-39923712 TCCTTCACACAGATGGCTGAAGG - Intronic
1181282129 22:21727771-21727793 TCCTCTACACAGGTGCCCCAGGG - Intronic
1182367350 22:29788151-29788173 TCCATCTCACAACTGGCCCAAGG - Intergenic
1182477265 22:30583030-30583052 GCCTCCACACAGCTGGCCCTGGG - Intronic
1183295332 22:37025862-37025884 TCCAAAACAATGCTGGCCCATGG - Intronic
1184533879 22:45073273-45073295 GGCTTTGCACAGCTGGCCCATGG + Intergenic
953931043 3:47005797-47005819 TCCTCAGGAGAGCTGGCCCACGG - Exonic
956057417 3:65315072-65315094 TGTTTAACACAGGTGGCACAAGG + Intergenic
961427681 3:126860890-126860912 TTCTTTTCACAGATGGCCCAAGG + Intronic
962487695 3:135860973-135860995 TTCTTACCACTGGTGGCCCAGGG + Intergenic
962826311 3:139103211-139103233 TCCCTTACACAGCTGGCCTTTGG + Intronic
964396390 3:156250356-156250378 TCCTGAACACAGCTGGCCTTGGG - Intronic
968620333 4:1601035-1601057 GCCTCAAGACAGCTGGCCCTGGG - Intergenic
969442803 4:7227308-7227330 TGCTTATCACCGCTGGCCCTGGG + Intronic
971415907 4:26429422-26429444 ACCTTAACACACCTAGACCAGGG - Intronic
973878552 4:55245646-55245668 TCCTTAAAACAGCTGGTCAATGG + Intergenic
974824135 4:67104862-67104884 GCCTTCCCACAACTGGCCCATGG - Intergenic
990186920 5:53219717-53219739 TTCTTAACGCAGCTAGCCCTTGG - Intergenic
991598800 5:68332164-68332186 TTGTTGACACTGCTGGCCCATGG + Intergenic
992158322 5:73976412-73976434 TCCTTAACCCAGCTGGTCAGTGG + Intergenic
994090887 5:95808634-95808656 TCTTTAACACAGTCTGCCCAGGG - Intronic
998270755 5:140704276-140704298 TCCTGGACCCAGCTGGCCAAGGG + Intronic
1000983822 5:167845570-167845592 TGCTTAAAACAGCTGGCATATGG + Intronic
1002969443 6:1998834-1998856 TGCTTAATACAGCTGTCCCTTGG - Intronic
1005262896 6:24080816-24080838 TTCTTAACAGAGCTGTTCCAGGG - Intergenic
1007509130 6:42362056-42362078 TCCCTGACACTGCTGGCCCTGGG + Intronic
1008427555 6:51377167-51377189 TCCCTAACAAAGCTGGGCCATGG - Intergenic
1013468305 6:110436934-110436956 TCCTTAACACATCAGCCGCAAGG - Intronic
1013645826 6:112140151-112140173 TACCTAACAAAGCTGGCGCAAGG - Intronic
1013953053 6:115808186-115808208 TCCTGGACACAGCTGTTCCAAGG + Intergenic
1017541214 6:155404919-155404941 TCCTTCAAATAGCTGGTCCAGGG + Intronic
1019441865 7:1051514-1051536 TCCTGTCCACTGCTGGCCCATGG + Intronic
1020388850 7:7636596-7636618 TCCTTAACACAGCTGGCCCAAGG + Exonic
1022770794 7:33470781-33470803 CACAGAACACAGCTGGCCCAAGG - Intronic
1028204386 7:87999002-87999024 TCCAAAACACATCTGGCCCCGGG + Intronic
1028711234 7:93911093-93911115 TTCTTAACATAGCTGGCACAGGG + Exonic
1028711589 7:93915288-93915310 TTCTTAACATAGCTGGCACAGGG + Intergenic
1031637099 7:124114998-124115020 TCCTAAACACTTCTGGCTCACGG - Intergenic
1032512928 7:132486472-132486494 GACTCAGCACAGCTGGCCCAGGG - Intronic
1032842399 7:135724680-135724702 TCCTTAATACAGCTGGGTGAAGG - Intronic
1034686431 7:152975368-152975390 TTCTCAAAACATCTGGCCCAGGG - Intergenic
1034828575 7:154289330-154289352 TGCGTAACACAGCAGGCACAGGG + Intronic
1036489639 8:9213171-9213193 TACCTAAATCAGCTGGCCCAAGG + Intergenic
1038246948 8:25867065-25867087 TCCTTAACACAACTGGCACAAGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1048634153 8:136277717-136277739 TCATTCACACAGCTGGCCCTTGG + Intergenic
1049009242 8:139876273-139876295 TCCTGAACGGAGCTGGCTCAGGG + Intronic
1049372383 8:142274014-142274036 TCCTGGCCCCAGCTGGCCCAGGG + Intronic
1049455329 8:142683609-142683631 TCCTGAACACTGGGGGCCCAGGG + Intergenic
1049656119 8:143798796-143798818 TCCTGAGCACGCCTGGCCCATGG + Intronic
1050027534 9:1351355-1351377 TCCCTCACTCAGCTGACCCAGGG + Intergenic
1050325676 9:4495246-4495268 TCCTAAACACTGCTGAGCCAAGG - Intronic
1052788783 9:32854786-32854808 TCCAGAACACAGTTGGCACAAGG - Intergenic
1055862690 9:80772042-80772064 TCATTAACACACATGGACCAAGG - Intergenic
1060664135 9:125422956-125422978 CGATTGACACAGCTGGCCCATGG + Intergenic
1061819407 9:133217739-133217761 TCCCAGCCACAGCTGGCCCACGG - Intergenic
1062241279 9:135540450-135540472 TCCCAGCCACAGCTGGCCCACGG + Intergenic
1193640348 X:84004257-84004279 ACCTTAAAACAGATGGCCCTAGG + Intergenic
1195935272 X:110119587-110119609 TCCTTGAACCAGCTGGTCCATGG + Intronic
1199034014 X:143030887-143030909 CCCTTAACCCAGCTGGCCTCAGG - Intronic
1202039554 Y:20667824-20667846 TCCTTAACACAATTGGCCTTCGG + Intergenic