ID: 1020389013

View in Genome Browser
Species Human (GRCh38)
Location 7:7639298-7639320
Sequence TATGTTATCAAATCTGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020389013 Original CRISPR TATGTTATCAAATCTGTTCA TGG Intronic
908022808 1:59915747-59915769 GATCTTATCAAATCTTCTCAGGG + Intronic
908106411 1:60847854-60847876 GATGTTATTAAATCTATTCATGG + Intergenic
908724584 1:67162037-67162059 TATTTTATCAAATCATATCATGG - Intronic
909425261 1:75516918-75516940 AAAATTATCAATTCTGTTCATGG + Intronic
910093777 1:83496432-83496454 TATGTCATCAAATCCTTGCAGGG + Intergenic
911577767 1:99598572-99598594 TATGCAATAAAATCTGTTGAAGG - Intergenic
911613844 1:99986972-99986994 AATGATTTCATATCTGTTCAAGG - Intronic
914719288 1:150276243-150276265 TAGGTTAACAAATCTGTTTTGGG - Intronic
914975857 1:152361064-152361086 AATGTTTTCAGATATGTTCAGGG + Intergenic
916092474 1:161318375-161318397 TATGTTCTCTAAACAGTTCAGGG + Intronic
916991842 1:170252712-170252734 TTTGTTATTAAAGTTGTTCACGG - Intergenic
918888493 1:190230404-190230426 TATGTTTTCAAAACTATTTAAGG - Intronic
921496716 1:215851912-215851934 TTTGTTTTCAATTCTGTTTATGG - Intronic
921934362 1:220783101-220783123 TATGTTATGAAATATGGTTATGG - Intronic
923803190 1:237230357-237230379 TTTGTTATCAAATCACTTCCTGG + Intronic
924035516 1:239932168-239932190 TATGTTTTCAAATATGTTTATGG + Intergenic
1062811957 10:473357-473379 TGTGGTATCAGAGCTGTTCATGG - Intronic
1063022215 10:2140897-2140919 AATTTAATCATATCTGTTCATGG - Intergenic
1067281153 10:44874215-44874237 TATGTTATTAAAGCTGTTTCAGG + Intergenic
1067758805 10:49027308-49027330 TATGTTCTCAAATGTGTGCCAGG + Intronic
1067817196 10:49489182-49489204 TACTTTATCAAAAATGTTCATGG - Intronic
1067979679 10:51071553-51071575 CATGATATAAAATCTGTTCCAGG - Intronic
1069485564 10:68820601-68820623 TTCTTTATCCAATCTGTTCATGG + Intergenic
1072547242 10:96449158-96449180 TTTGTTTCCTAATCTGTTCATGG - Intronic
1073668580 10:105561470-105561492 TTTGTTGTCAGATCTCTTCATGG + Intergenic
1073997400 10:109331781-109331803 TGTGTTATTAAATCTGTTCAAGG - Intergenic
1074012923 10:109502498-109502520 AATGGTATTAAATCTGTTTAGGG + Intergenic
1074643367 10:115414926-115414948 TAGGTTAACAAATCTATTCGGGG + Intronic
1075600973 10:123768978-123769000 TATGTTATTTGATCTGTTCTTGG - Intronic
1078412502 11:11137840-11137862 TGTGATATCAAATCTGTCCCTGG + Intergenic
1079642724 11:22827320-22827342 TTTCTTATCAAATTTCTTCAAGG - Exonic
1080114112 11:28602580-28602602 TAAGTTAGCCAATGTGTTCAAGG - Intergenic
1080487348 11:32723564-32723586 TATGTACCTAAATCTGTTCAGGG + Intronic
1081281430 11:41213271-41213293 TATATTATCACATCATTTCATGG - Intronic
1086162358 11:83736256-83736278 TAAGTAATCTAATCTGCTCAGGG - Intronic
1088211319 11:107459806-107459828 TATTCTTTCACATCTGTTCACGG + Intergenic
1090538709 11:127676490-127676512 GATTTTATCTGATCTGTTCATGG - Intergenic
1091571415 12:1690288-1690310 TACGTAACCAAATCTGTTCTTGG + Intronic
1093017219 12:14166735-14166757 TATGTTAACAAACATGTGCATGG - Intergenic
1093110877 12:15150565-15150587 TATGTTCCCAGATCTGTTCTAGG + Intronic
1093621843 12:21301094-21301116 TATGTTATCATATATAATCATGG - Intronic
1093675074 12:21928590-21928612 TTTCTTATCAAACCTGTTTAAGG - Intronic
1094031703 12:26019497-26019519 TATGTTATTTAGTCTGTTCTGGG - Intronic
1094578487 12:31710672-31710694 TATCTTATGAAATCCCTTCAAGG + Intronic
1096482957 12:51954578-51954600 TGTTTTATCACATCTGTTCCAGG - Intronic
1096934706 12:55258686-55258708 TAGGTTCTCAATTCAGTTCAAGG - Intergenic
1099378258 12:81920955-81920977 TATATTAATTAATCTGTTCAAGG + Intergenic
1099504663 12:83458638-83458660 TATGTTTTCAAATGTGTGTAAGG + Intergenic
1099863860 12:88254036-88254058 AATGTTATAAAATGTGTTTAAGG - Intergenic
1100892539 12:99141752-99141774 CATGTTATCATACCTTTTCATGG + Intronic
1104425506 12:128674076-128674098 AATGTTATAAAATCGGATCATGG - Intronic
1108375784 13:49812865-49812887 TGTGTTATCAAATTTCTACAGGG + Intergenic
1109935258 13:69274524-69274546 TATGTTATCACCTCTGCCCAGGG + Intergenic
1111099094 13:83557484-83557506 AGTATTATCAAATCTGTTGAGGG - Intergenic
1111266775 13:85825675-85825697 AATGTAAGCAAATCTGTTCCAGG - Intergenic
1111314345 13:86533291-86533313 TAGGGTATCAAATGTGTCCATGG - Intergenic
1111340474 13:86879195-86879217 TTTGTTAGCAAATTTGTTTAAGG + Intergenic
1111972186 13:94928267-94928289 TATGGAAGCATATCTGTTCAAGG - Intergenic
1112487426 13:99832817-99832839 TGTTATATCAAATCTGTTAAAGG + Intronic
1116548065 14:46196991-46197013 AATTTTATAAAATCTCTTCATGG + Intergenic
1118660218 14:68001120-68001142 TATGTAATCCAATCAGTTCTTGG + Intronic
1119035374 14:71225940-71225962 TTTGTTTTCAATTTTGTTCATGG + Intergenic
1119704326 14:76774519-76774541 TATGGTCTCAAAGCTTTTCAGGG + Intronic
1120084765 14:80259099-80259121 TATGTTATTAAATATACTCACGG - Intronic
1120601006 14:86509344-86509366 TATTTTATAAAATTTGTTCTTGG - Intergenic
1124911417 15:33924663-33924685 TATTTTATCAAATACGTTCATGG + Intronic
1125347165 15:38729998-38730020 GAAGTTATCCAATCTGTTGAGGG - Intergenic
1127678498 15:61269465-61269487 TATGTGATCAAATATTTTCTGGG + Intergenic
1128168399 15:65488348-65488370 TAGGTCATGAAATCTGTTAACGG + Intronic
1128840612 15:70848138-70848160 TATGTTCTCAACTTTGTTAAAGG + Intronic
1130753085 15:86734185-86734207 AATGTTATGAAAGTTGTTCAAGG + Intronic
1131489184 15:92847734-92847756 TATCTCATCAAATCAGTTGAAGG - Intergenic
1133907248 16:10033570-10033592 CCTGTTTCCAAATCTGTTCATGG + Intronic
1134474418 16:14560104-14560126 TATTTTATCAAATCATTCCAGGG - Intronic
1138139051 16:54551124-54551146 TATTTTAAAAAATCTGTACAAGG - Intergenic
1140646075 16:77031542-77031564 ACTGTTATCAGATCTCTTCAGGG + Intergenic
1142312499 16:89322241-89322263 AATGTTGTCACATCTGTTCAGGG - Intronic
1144369030 17:14572315-14572337 GATGTTTTCAACTCTGTACAGGG + Intergenic
1147254960 17:39175874-39175896 TATGTCCTCACATCTGTTGAAGG - Intronic
1147660836 17:42116141-42116163 TACGTTAGGAAATGTGTTCAAGG + Intronic
1149154647 17:53612574-53612596 TATGGTGTTAAATCTGATCAGGG + Intergenic
1149506139 17:57195474-57195496 CATTCTATTAAATCTGTTCATGG - Intergenic
1150604302 17:66677679-66677701 GATGTTAACAAACCTGCTCAAGG - Intronic
1151346012 17:73501714-73501736 TTTGTTATCAGATCTGTTCCAGG + Intronic
1153111380 18:1593046-1593068 TATGCTTTTAAATCTTTTCATGG - Intergenic
1153261658 18:3230228-3230250 TTTGTTACAAAATCTCTTCAAGG + Intergenic
1155489790 18:26389168-26389190 TAGGTTAAGCAATCTGTTCAAGG - Intronic
1158289105 18:55918788-55918810 TCTGTCATCAAATCTGTTGATGG + Intergenic
1158401580 18:57126365-57126387 CATGTTGACAAATCAGTTCAAGG - Intergenic
1158710715 18:59835508-59835530 TTTGTTATCAAGTCTCTTCCAGG + Intergenic
1161623459 19:5311635-5311657 TGTCTCATCAAAGCTGTTCAGGG + Intronic
1163870672 19:19819027-19819049 TAAGTGAACAAATCTTTTCAAGG + Intronic
1163874784 19:19858882-19858904 TAAGTAAACAAATCTTTTCAAGG + Intergenic
1163958753 19:20667426-20667448 TAAGTGAACAAATCTTTTCAAGG - Intronic
1163983781 19:20925819-20925841 TAAGTGAACAAATCTTTTCAAGG - Intronic
1163999565 19:21084618-21084640 TAAGTGAACAAATCTCTTCAAGG - Intronic
1164023162 19:21327177-21327199 TAAGTGAACAAATCTTTTCAAGG + Intronic
1164027124 19:21362584-21362606 TAAGTGAACAAATCTCTTCAAGG - Intronic
1164030555 19:21399503-21399525 TAAGTGAACAAATCTCTTCAAGG - Intronic
1164048766 19:21566159-21566181 TAAGTGAACAAATCTTTTCAAGG + Intergenic
1164055487 19:21618577-21618599 TAAGTGAACAAATCTGTTCAAGG - Intergenic
1164176626 19:22781203-22781225 TAAGTGAACAAATCTTTTCAAGG + Intronic
1164226074 19:23247418-23247440 TAAGTGAACAAATCTTTTCAAGG + Intronic
1164230035 19:23279118-23279140 TAAGTGAACAAATCTTTTCAAGG - Intergenic
1164306969 19:24012261-24012283 TAAGTGAACAAATCTTTTCAAGG + Intergenic
1164991054 19:32684289-32684311 TATGTAATGAAATCTGTGAAGGG - Intergenic
1165530698 19:36397913-36397935 TAATTTATCAAAACTGATCATGG + Intronic
1167625861 19:50588729-50588751 TATGTAATCAAACATATTCACGG - Intergenic
1168517574 19:57021178-57021200 AAAGTTATCTAATCTGTTGAGGG + Intergenic
927345225 2:22030646-22030668 TTTGTTATCAAATTATTTCAAGG + Intergenic
928230282 2:29492853-29492875 TCTGTTTTTAAATTTGTTCAAGG - Intronic
928806845 2:35168817-35168839 TCTGTTATCAAATCTTCTTAAGG + Intergenic
928943960 2:36755535-36755557 TATTTTACCATATCTGTCCATGG + Intronic
929425917 2:41844641-41844663 TGAGTTATAAAATCTCTTCATGG - Intergenic
934060721 2:88290327-88290349 GATGTTTTAAAATATGTTCAAGG + Intergenic
938725195 2:134102600-134102622 TATATTATAAAATCTCTTAAAGG - Intergenic
941040090 2:160611773-160611795 AATGTTATCAAATCACTGCAGGG - Intergenic
941182926 2:162283374-162283396 TATGTTATAACATCTGCTGAAGG + Intronic
941279183 2:163529070-163529092 TGTGCTATCTTATCTGTTCAGGG + Intergenic
941544825 2:166835835-166835857 TATGTCATCATATCTATTTAAGG + Intergenic
942289524 2:174455269-174455291 CATGTTATCACTTCTCTTCAGGG - Intronic
943324638 2:186483664-186483686 TATGTCTTCAAATATGTTTATGG + Intergenic
943445024 2:187974022-187974044 TATGTTACCAAGTCACTTCACGG + Intergenic
944054775 2:195512189-195512211 GATGTTATCAAATGTCTTCTGGG + Intergenic
944298902 2:198100321-198100343 TATTTTTTTAAATCTGTTCATGG - Intronic
945129379 2:206552595-206552617 TAGGCTATCAAATCTTTTAAGGG + Intronic
945367325 2:208971426-208971448 TATGTTATCAATTAATTTCATGG - Intergenic
945523659 2:210861301-210861323 TATGTTTTGAAATCTGTTTGAGG + Intergenic
946085402 2:217165553-217165575 TTTGTTATCATAACTGTGCATGG - Intergenic
947787329 2:232835402-232835424 TATGTTATAAAAGTTGTTCAGGG - Intronic
1169243513 20:4005952-4005974 TATGATATTAAATCTGCTAAAGG + Intronic
1170175185 20:13460939-13460961 TATCTTCTCAAAACTCTTCAAGG + Intronic
1170640622 20:18149438-18149460 CATTTTTTAAAATCTGTTCATGG + Intronic
1171951440 20:31426157-31426179 TAAGTGAACAAATCTTTTCAAGG - Intergenic
1173567058 20:44048559-44048581 TATGTTATCTATACTGTTCCAGG + Intronic
1174568322 20:51483211-51483233 TCTGCTATCAACTCTGCTCAGGG + Intronic
1174994956 20:55556165-55556187 TATGTTCTAATATCTGTTCTAGG - Intergenic
1176958609 21:15134305-15134327 TATTTTACCATATCTGTTCTGGG - Intergenic
1177760001 21:25392506-25392528 TCTGTTATCAAATCTGGAAAAGG - Intergenic
1179067909 21:38043579-38043601 TTTGTTATCATCTCTGTACATGG + Intronic
1181344975 22:22212727-22212749 TATGTTATCCAATATCTTTATGG - Intergenic
1181421904 22:22806470-22806492 TATGTCTTCAAATTTGTTCATGG - Intronic
1184575199 22:45358279-45358301 CATATTATCAAATCTGTGGAAGG + Intronic
949276463 3:2288707-2288729 TATGTTATCAAATAAGTGGAAGG + Intronic
951802928 3:26616745-26616767 GATGTTATGAAGTCTCTTCATGG + Intergenic
952582817 3:34854479-34854501 TATTTAGTCAAATCTTTTCATGG - Intergenic
953402260 3:42634785-42634807 TATAATACAAAATCTGTTCAAGG + Intronic
956510399 3:69987514-69987536 TCTTTTATCAAATATGTTAATGG + Intergenic
957228338 3:77477698-77477720 AATGTTTTTAAATCTTTTCAAGG - Intronic
957233433 3:77551892-77551914 TATTTTTTAATATCTGTTCATGG + Intronic
958537873 3:95427222-95427244 TATGATATCCTATCTGTTCTTGG + Intergenic
960355964 3:116653879-116653901 TAGGATATCAAATGAGTTCAAGG + Intronic
960697132 3:120407185-120407207 TATGTCATGAGATCTGTTCTTGG + Intronic
961425268 3:126840625-126840647 TCTGTTATCTAATATGGTCATGG + Intronic
962726127 3:138228858-138228880 TATTTTATCAAATGTACTCATGG + Intronic
963325903 3:143862886-143862908 TATGTTGTAAAGTCTGCTCATGG - Intergenic
963504226 3:146163799-146163821 TCTGTTATGAAATCTGTTTGGGG - Intergenic
963506182 3:146187790-146187812 CATGTTTTCAAAACTGTTTAAGG + Intergenic
964948200 3:162252037-162252059 TATTTTATCTAATATGTTTAGGG + Intergenic
965764722 3:172118386-172118408 TATGTAAGCAAAACTCTTCACGG - Intronic
966161117 3:176969515-176969537 TATATTTCCCAATCTGTTCATGG + Intergenic
966183300 3:177206071-177206093 CATGTTATCAACTCTTTTCAAGG + Intergenic
966944941 3:184771079-184771101 TATGGAATGAAAACTGTTCAGGG - Intergenic
967271287 3:187735692-187735714 TATTTCATTAAATCTCTTCAAGG - Intronic
967817419 3:193811278-193811300 TGTGTTCTCAAACCTGTTCTTGG + Intergenic
970725713 4:19041974-19041996 TCTGTTATCAATACTGTTAAAGG + Intergenic
974638320 4:64594379-64594401 AATCTTTTCAAATGTGTTCAGGG - Intergenic
976078412 4:81325441-81325463 TATGTTTTAAAACCTGTTAAAGG + Intergenic
976505663 4:85843981-85844003 TATGTTATCAATTATGTTTTAGG - Intronic
976535163 4:86205749-86205771 TATCATTTCAAATCTATTCATGG + Intronic
976783356 4:88787131-88787153 TATTTTATTAAATCTTTTCATGG + Intronic
977436930 4:97009960-97009982 AATGTTATCAATTCTGTGTATGG + Intergenic
977723590 4:100268227-100268249 CATGTTATCAAAGGTGTTCCTGG - Intergenic
978072172 4:104487788-104487810 TATCATATCAAATATGATCAAGG + Intronic
978670250 4:111239773-111239795 TATCTTGCCAAATCTTTTCAGGG + Intergenic
980678562 4:136124668-136124690 TATGTTGTCAAATCAGATTAAGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
983927659 4:173418993-173419015 TATGTTCTCAAATCGCTACAAGG - Intergenic
988295566 5:29355935-29355957 AGTGTTATCAATTCTGTTGATGG - Intergenic
990346020 5:54872605-54872627 TATATTATCATCTCTTTTCAGGG + Intergenic
991192418 5:63889826-63889848 GATTTTATCAAATTTGTTAAAGG - Intergenic
992001425 5:72440177-72440199 TATTTTATTAAATGCGTTCAGGG + Intergenic
992106789 5:73455134-73455156 CAAGTTATTAAAACTGTTCACGG - Intergenic
992684200 5:79183348-79183370 AATATTATCAAAACTGTTCTTGG - Intronic
992784599 5:80157347-80157369 TATTCTATCAAATATCTTCATGG + Intronic
994357737 5:98813135-98813157 TATGTTATCATATCCATTTATGG + Intergenic
994938035 5:106281714-106281736 TATTTTATCACTTTTGTTCATGG - Intergenic
1000114793 5:158143540-158143562 GATCTTATCAAATCTGGTCAAGG - Intergenic
1001023609 5:168204801-168204823 TATTGTATCAAATCTGTGTATGG - Intronic
1004236280 6:13877579-13877601 TTTGTTTTCAAATCAGTCCAAGG + Intergenic
1004633179 6:17441300-17441322 TATGTAAACTAATTTGTTCAAGG + Intronic
1007565849 6:42849737-42849759 TATGTTAACATTTCTGTTCTAGG - Intronic
1008097785 6:47357657-47357679 AATGTTATCATATTTGATCATGG + Intergenic
1011105978 6:83782076-83782098 GATGTTAAGTAATCTGTTCAAGG + Intergenic
1013506908 6:110809783-110809805 TATGTGACCAACTCTGTACAAGG + Intronic
1013655087 6:112238178-112238200 TATGTTACAAAAACTCTTCAAGG - Intronic
1015213573 6:130723907-130723929 CATGTCATCGAATCTCTTCAGGG + Intergenic
1016053121 6:139550902-139550924 TATGTTATAATATTTGTTCCTGG - Intergenic
1017513536 6:155135639-155135661 TATGTTTTCAGCTCTGTGCATGG + Intronic
1017633495 6:156422038-156422060 TATGTTATCCACTGTCTTCATGG - Intergenic
1018817915 6:167349761-167349783 TACGTTCTCAACTCTGTTCCAGG + Intronic
1019033841 6:169037390-169037412 TTTGTTGTTAATTCTGTTCATGG - Intergenic
1020389013 7:7639298-7639320 TATGTTATCAAATCTGTTCATGG + Intronic
1022034812 7:26523744-26523766 TATCTTATCAAAAGTGTTCAGGG + Intergenic
1022424536 7:30255875-30255897 ATTGTTAAGAAATCTGTTCAAGG + Intergenic
1023354183 7:39350761-39350783 CATGTAATCAAATATTTTCAGGG + Intronic
1023781541 7:43660484-43660506 TATCTTATCAAATCTTCTTAAGG + Intronic
1024389930 7:48796903-48796925 TATTTTCTCAAATTTGTTGAGGG + Intergenic
1025788819 7:64668528-64668550 TAAGTGAACAAATCTTTTCAAGG - Intronic
1025802153 7:64796437-64796459 TAAGTGAACAAATCTTTTCAGGG - Intronic
1026247292 7:68632567-68632589 TAGGTTATCAAATCAGTCCAGGG - Intergenic
1027607613 7:80319365-80319387 TAATTTATAAAATCTGTTAAAGG + Intergenic
1027806068 7:82824483-82824505 TATGTTCTAAAATTTATTCAAGG + Intronic
1027924349 7:84441209-84441231 TCTGTTATAAGATCTTTTCAGGG - Intronic
1030604405 7:111624021-111624043 TATGTGATGATATATGTTCAAGG + Intergenic
1030940722 7:115645930-115645952 AAAGTTGTCAAATCAGTTCAAGG + Intergenic
1032232905 7:130091343-130091365 TGTTTTATCAAAACTGATCATGG - Intronic
1032762169 7:134953593-134953615 CATGTTACCAAGACTGTTCAAGG - Intronic
1033900780 7:146136405-146136427 TAAGATATAAAATATGTTCATGG - Intronic
1035868187 8:3108113-3108135 GACGTTATCAAATCTGCACATGG - Intronic
1036909128 8:12738483-12738505 TATGCTATCAAAATAGTTCATGG + Intronic
1036983432 8:13497720-13497742 TATCCTATCAAATCTGTTTGAGG - Intronic
1037143369 8:15543862-15543884 TATGATACCAAATCTCTTCCTGG - Intronic
1038855838 8:31332429-31332451 TCTGTCATCAGATCTTTTCAAGG + Intergenic
1039917183 8:41868809-41868831 TCTGTTATAAAATTTGTTCCAGG - Intronic
1040831221 8:51679435-51679457 TATGTTAAGTAATTTGTTCAAGG - Intronic
1042277601 8:67021546-67021568 TATTTTATGAAATATTTTCAAGG - Intronic
1042727375 8:71892900-71892922 TTTTTTATCAAATCTGTTGCTGG + Intronic
1043601309 8:81941787-81941809 TTTGTTATCTTATCTGTGCATGG - Intergenic
1045333219 8:101175108-101175130 TATCTTAACAAATCTTTACAGGG + Intergenic
1046269960 8:111881927-111881949 TATGTTCTAAAATCTATTCAAGG + Intergenic
1048459916 8:134613185-134613207 AATGTGAACAAATCTGTTCCTGG - Intronic
1048634868 8:136284869-136284891 GATGTCATCCAATCTGTTGAGGG + Intergenic
1050113303 9:2238935-2238957 TATGAAATCAAATTTGTCCAGGG - Intergenic
1050737964 9:8786352-8786374 TATGTTTTGAAATTTGTTCCAGG + Intronic
1050742542 9:8838923-8838945 TATATAGTCAAATCTGTTGATGG - Intronic
1050921725 9:11212134-11212156 TATGTTCTCTAATTGGTTCAGGG + Intergenic
1051664145 9:19452478-19452500 TATGTTATTAAATTTATTTAAGG + Intergenic
1051712935 9:19950375-19950397 TTTATTATAAAATCTGTCCAGGG + Intergenic
1051713722 9:19959626-19959648 TATGTTATTTTATCTTTTCATGG + Intergenic
1052612474 9:30793418-30793440 TATGTTCTCAAATATGTTCTGGG - Intergenic
1053190941 9:36067936-36067958 TATGTTATCAAAAATGCACATGG + Intronic
1058123881 9:101169686-101169708 CATGTTATCAAATGTTATCAAGG + Intronic
1059714145 9:116897683-116897705 TATTTTTTGAACTCTGTTCATGG - Intronic
1187761050 X:22585410-22585432 TATGGTATCAAATGTGGTGATGG + Intergenic
1188906247 X:35795239-35795261 TATGTTATCAAATTAGGTAAAGG - Intergenic
1189927184 X:45968634-45968656 TATATTATTAAATCTCATCATGG - Intergenic
1192090334 X:68148382-68148404 TGTGTTATCATATCTCCTCAGGG + Intronic
1192773735 X:74220616-74220638 AATGTTTTCAAATCTGGACAGGG - Intergenic
1193678767 X:84490616-84490638 TACATTATCAAAACTGTTAAAGG - Intronic
1193979602 X:88165539-88165561 TCCATTATCAAATCTGTTCCTGG - Intergenic
1195141345 X:101963630-101963652 TGGTTTATCAAATCTTTTCATGG - Intergenic
1195142687 X:101978865-101978887 TTTATAATCAAATGTGTTCAGGG + Intergenic
1199140122 X:144301316-144301338 TATGTTCTCACATCTGATCTTGG - Intergenic
1199678262 X:150205844-150205866 TATGTTCTCTAATCTGGTGATGG - Intergenic
1200660290 Y:5948885-5948907 TATGTTTTTAAAACTGTTGAAGG - Intergenic