ID: 1020389177

View in Genome Browser
Species Human (GRCh38)
Location 7:7640625-7640647
Sequence ATTGGCTGCTTAGTGACGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020389177 Original CRISPR ATTGGCTGCTTAGTGACGCG CGG Exonic
921367392 1:214386626-214386648 ATTGGCTGCTCAGGGAGTCGGGG - Intronic
1069737601 10:70667407-70667429 CTTAGCTGCTTAGTCACGAGGGG - Intergenic
1084938708 11:72601064-72601086 CTTGGCTGCTTACTGATGCCTGG - Intronic
1089923333 11:122231100-122231122 CTTAGCTGCTTAGTGATGGGAGG - Intergenic
1090989401 11:131802558-131802580 ATTGCCTGGTAAGTGATGCGTGG + Intronic
1101682986 12:106987212-106987234 ACTGGCTGCGTTGGGACGCGGGG - Intergenic
1103315992 12:120056341-120056363 ACTGGCTGCTTAGTTAGGCATGG + Intronic
1105050802 12:133048952-133048974 GTTGGCTGGTCAGTGACGGGTGG + Intronic
1120946111 14:89998722-89998744 ATGGGTTGCTGAGGGACGCGGGG + Intronic
1123978144 15:25572355-25572377 ATTGGCAGGCTAGAGACGCGGGG + Intergenic
1129844764 15:78763185-78763207 ACTGGCTGCTGAGTGACTCTGGG - Intronic
1130257057 15:82330668-82330690 ACTGGCTGCTGAGTGACTCTGGG + Intergenic
1130597893 15:85259322-85259344 ACTGGCTGCTGAGTGACTCTGGG - Intergenic
1146583307 17:34059344-34059366 ATGGGCTGCTTAGAGACCCAGGG - Intronic
1153508450 18:5827916-5827938 ATTGGCAGCTTAGTTAGGAGTGG + Intergenic
1166502893 19:43354263-43354285 ATCCGGTGCTCAGTGACGCGGGG - Exonic
1168429729 19:56268756-56268778 AATGGCTGCTTAGTGAGATGGGG - Intronic
934873271 2:97887508-97887530 ATTAGCTGCTTAGAGGCCCGGGG + Intronic
1176312731 21:5161968-5161990 TTTGACTGCTTTGTGAAGCGTGG - Intergenic
1178873848 21:36397295-36397317 ACTGCCTGCTGAGTGATGCGTGG + Intronic
1179844317 21:44100062-44100084 TTTGACTGCTTTGTGAAGCGTGG + Intronic
1180921654 22:19524473-19524495 ATTGGCTGCTTCGGGCCGGGGGG - Exonic
957329304 3:78739992-78740014 ATTGGCTGGTTAGGGAAGAGAGG - Intronic
966955299 3:184871014-184871036 CTTAGCTGCTTAGTGGCGTGTGG + Intronic
969042345 4:4308983-4309005 ATTGTCTGCATAGGGATGCGTGG + Intronic
973007540 4:45031121-45031143 ATTAGCTGCTAACTGACGTGAGG + Intergenic
977172974 4:93785645-93785667 AATGGCTTCTTAGTGATGCCTGG - Intergenic
993044926 5:82856237-82856259 ATTTGTTGCTTAGTGACATGAGG + Intergenic
998534788 5:142919599-142919621 ATGGGCTGCTTTGTGAAGTGGGG - Intronic
1005697059 6:28361386-28361408 ATTGGCTACTTTGTGACCCTGGG - Exonic
1018233079 6:161694841-161694863 ATTGGCAGCTTTGTGAAGTGGGG + Intronic
1020389177 7:7640625-7640647 ATTGGCTGCTTAGTGACGCGCGG + Exonic
1020450425 7:8315330-8315352 ATTTGCTGCTTAGAGACTAGAGG - Intergenic
1027402333 7:77822055-77822077 ATCAGCTGCTTAGAGACGTGGGG + Intronic
1029420201 7:100468135-100468157 ATTGGCTCCTTGGGGACACGGGG + Intronic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1049034453 8:140063330-140063352 ATTGACTGCGTGGTGACGTGAGG - Intronic
1055167396 9:73213434-73213456 ATTGGCTACTTACTGACTCTGGG + Intergenic
1186585542 X:10869443-10869465 ATTTGATGCTTAGTGAAGGGAGG + Intergenic
1199539070 X:148937942-148937964 TTTGGCTGCTTAGTTACCAGCGG - Intronic