ID: 1020389177

View in Genome Browser
Species Human (GRCh38)
Location 7:7640625-7640647
Sequence ATTGGCTGCTTAGTGACGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020389177 Original CRISPR ATTGGCTGCTTAGTGACGCG CGG Exonic