ID: 1020390638

View in Genome Browser
Species Human (GRCh38)
Location 7:7654299-7654321
Sequence CTGTATTCAGTGATGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020390634_1020390638 -8 Left 1020390634 7:7654284-7654306 CCCAAGTGAGGCCATCTGTATTC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG 0: 1
1: 0
2: 3
3: 24
4: 221
1020390635_1020390638 -9 Left 1020390635 7:7654285-7654307 CCAAGTGAGGCCATCTGTATTCA 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG 0: 1
1: 0
2: 3
3: 24
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020390638 Original CRISPR CTGTATTCAGTGATGGAAAT AGG Intronic
900626160 1:3609664-3609686 CTGTTTGAAGTGGTGGAAATGGG - Intronic
901817382 1:11802619-11802641 CTGTATTCTTTGAGGGAACTTGG - Intronic
902942318 1:19809262-19809284 CTGTATTCAGTCAGGGATATTGG + Intergenic
904637281 1:31892124-31892146 CTGTGTTCAGTGATGTCAATTGG + Intergenic
905651583 1:39660587-39660609 CTGTTTCCAGTGAGGGAAACAGG + Intronic
905721621 1:40208054-40208076 CTTTATTCTGGGATGGATATTGG + Intronic
905921258 1:41720432-41720454 GTATATTCAGTGCTGGAACTGGG - Intronic
906414149 1:45606641-45606663 TTGTATACAGTGGTGGAAACGGG + Intronic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
909148232 1:71965570-71965592 CTTTATTTATTCATGGAAATGGG + Intronic
909606422 1:77513165-77513187 GTGTCTTCAGTAATGGAACTTGG - Intronic
910761392 1:90736040-90736062 CTCTATTCAGAAATGGCAATAGG + Intergenic
911688722 1:100807150-100807172 CAGTAATGAGTGATGGAACTAGG - Intergenic
911964138 1:104344473-104344495 ATGTATGCAGTGATTTAAATGGG - Intergenic
912510817 1:110189052-110189074 CTGCATTCAGTGTTGGAGATAGG + Intronic
912891380 1:113535771-113535793 CTGAATTTAGGGCTGGAAATTGG - Intronic
914994057 1:152524984-152525006 CTCTATTCAATTATGGAACTTGG + Intronic
917254163 1:173096811-173096833 CTCTATTCAGTGCTGGCAAAGGG + Intergenic
917701838 1:177589653-177589675 CTCTGTTCTGTGATGGAATTTGG - Intergenic
918102249 1:181386545-181386567 CTTTTTGCAGTGATGGAAATTGG + Intergenic
920128122 1:203710032-203710054 CTGTAATCAGAAATGGGAATGGG - Intronic
920405561 1:205706848-205706870 CAGAACTCAGTGATAGAAATTGG + Intergenic
923105004 1:230847695-230847717 CTGTATTCTGTTGTGGAATTTGG - Intronic
924862572 1:247939832-247939854 GTGTGTTGAGTGATTGAAATCGG - Intronic
1063105774 10:2990612-2990634 CTGTATTCATTGATTGGAGTTGG - Intergenic
1065080160 10:22121391-22121413 GGGTATTCAGTGAGGGAAAGAGG - Intergenic
1065489781 10:26271203-26271225 CTGTATTTAGAGAGGAAAATAGG + Intronic
1066525795 10:36277767-36277789 CTGTATGCAGTTAAGGAATTTGG + Intergenic
1068980560 10:63058269-63058291 CTGTATTTATTCAGGGAAATGGG + Intergenic
1070205025 10:74249881-74249903 CTGTATTCAGTGTCTAAAATAGG - Intronic
1070387323 10:75937583-75937605 GTGTCTTAACTGATGGAAATTGG - Intronic
1072867435 10:99079077-99079099 CCGTATTGAGTCATGGAAAGCGG + Intronic
1074708522 10:116157778-116157800 TTGTATACAGTGCTGGAAATAGG - Intronic
1075364208 10:121869148-121869170 CTCAAATAAGTGATGGAAATGGG - Intronic
1079814488 11:25039026-25039048 CTGTTTTCTGTGGTGTAAATAGG + Intronic
1080233914 11:30046960-30046982 CTGCATTCATTGATGGTTATGGG + Intergenic
1081360714 11:42174556-42174578 TTGTATTCAGAGATGGGAAATGG - Intergenic
1083066542 11:59929866-59929888 CCTTAAGCAGTGATGGAAATTGG + Intergenic
1083373491 11:62201101-62201123 CGGTAAACAGTGATGAAAATAGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085088543 11:73690055-73690077 CTGTATTAAATTATGGAAATAGG - Intronic
1086476345 11:87178852-87178874 CAGTTTTCAGTTATGAAAATTGG + Intronic
1086601419 11:88638488-88638510 CTGTCTTCATTGATTGAATTAGG + Intronic
1088697236 11:112378442-112378464 CTGTATTCAGGGAGTGATATAGG + Intergenic
1093274812 12:17111786-17111808 TTTTATTAAGTTATGGAAATTGG + Intergenic
1094247197 12:28312032-28312054 CTCTATTTATTGATAGAAATAGG + Intronic
1094704712 12:32903308-32903330 CTGTATATATTGATGGATATAGG + Intergenic
1095414414 12:41960509-41960531 TTTTAGTCAGTGATGTAAATTGG + Intergenic
1095645638 12:44542730-44542752 CTGCATTCAGTCAGGAAAATTGG + Intronic
1096319618 12:50599839-50599861 CTGTTTTCTGCGATGGCAATAGG + Intronic
1096332199 12:50723480-50723502 CATTATTCAGTGAAGGAACTGGG + Intronic
1097494342 12:60311921-60311943 CTACTTTCAGTCATGGAAATTGG - Intergenic
1099582758 12:84473679-84473701 ATGAATTCATTGATGGAATTAGG + Intergenic
1099590806 12:84586862-84586884 CTGTAAGCATTGATGGTAATGGG + Intergenic
1100183896 12:92116157-92116179 ATGTATTAAGTGATGCTAATAGG - Intronic
1100967262 12:100026593-100026615 CTGTTTTCAGTTTTGGTAATTGG + Intergenic
1101647279 12:106643103-106643125 CTGTATTCAGTGATGGACAATGG - Intronic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG + Intergenic
1105052383 12:133066270-133066292 CTGTATTCAGTGACTGAAAGAGG - Intergenic
1105957620 13:25299532-25299554 CTATTTTCAGTGATGGCTATAGG - Intergenic
1106057522 13:26252614-26252636 TTCCATTCAGTGATGAAAATTGG - Intergenic
1106256306 13:28025316-28025338 CTGTATTATGTGAGGGAAAGTGG - Intronic
1108596883 13:51956884-51956906 AGGTATTCAGTAATGGAATTGGG - Intronic
1110071322 13:71182556-71182578 TTTTATTGAGTGGTGGAAATGGG + Intergenic
1110208470 13:72946106-72946128 CTGTAATCAATGAAGGAAAGAGG + Intronic
1111536937 13:89614073-89614095 CTGTATTGAATTATGCAAATAGG - Intergenic
1111831261 13:93332876-93332898 TTGTATTCAGTGAGAGACATGGG + Intronic
1112154165 13:96799059-96799081 CTGTATTTAGATATGGAGATAGG - Intronic
1114380189 14:22194847-22194869 CTCTATACAGTGAAGGCAATGGG + Intergenic
1115036772 14:28867166-28867188 CAGTACTCAGTGCTGTAAATAGG - Intergenic
1119928983 14:78525874-78525896 ATGTATGCAGTGAAGGAACTAGG + Intronic
1120546353 14:85816718-85816740 CTGTATTCAGTGATTCCAGTGGG + Intergenic
1120689942 14:87581273-87581295 CTCTATTGAGTATTGGAAATAGG - Intergenic
1126297869 15:47161449-47161471 CTCAATTCAATGATGGAAAAAGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1127679033 15:61274925-61274947 ATGTATACAGTGAGGCAAATGGG + Intergenic
1129055603 15:72817782-72817804 CTCGAGTAAGTGATGGAAATTGG - Intergenic
1129291824 15:74574179-74574201 TTGTATTCAGTCATAGCAATGGG + Intronic
1131970357 15:97886135-97886157 CTGTTTTCAGCAATGAAAATTGG + Intergenic
1133571959 16:7049764-7049786 CTGCATTCAGTGGGGGAAACAGG + Intronic
1135656134 16:24251737-24251759 CTCTAGACAGTGATAGAAATTGG - Intergenic
1137661016 16:50206500-50206522 CTGACTTCAGTTATGGAACTGGG + Intronic
1138155884 16:54702473-54702495 CTGTGTCCAGTGGTGGAGATGGG + Intergenic
1138602806 16:58066820-58066842 TTGTAGTCAGTGATGGGAAGGGG - Intergenic
1143039422 17:4022550-4022572 CTGTATTCCCTGTTGGAAATAGG - Intronic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1144370801 17:14589743-14589765 CTGTGTTCAGGGAGAGAAATAGG + Intergenic
1147529732 17:41264447-41264469 CTGTTTTCAGTGAGGGAATTAGG - Intergenic
1151769210 17:76148878-76148900 GGGTAGTCAGTGATGGAAAAAGG - Intronic
1151979928 17:77502741-77502763 CTGTGTGCAAGGATGGAAATTGG - Intergenic
1153386582 18:4504599-4504621 ATGTATTCACTGCTGAAAATGGG - Intergenic
1153616865 18:6943316-6943338 CTGTGCTCTGTGATGGAAAATGG - Exonic
1153741580 18:8135256-8135278 GTGCAATCAATGATGGAAATTGG + Intronic
1154258946 18:12811929-12811951 CTTTCTTCAGTGAGAGAAATGGG - Intronic
1155382515 18:25239760-25239782 CTGTTGTCAGAGCTGGAAATAGG + Intronic
1155631409 18:27897592-27897614 CTGCATTCAGTTATGGTTATGGG + Intergenic
1156612224 18:38738373-38738395 CTGGGGGCAGTGATGGAAATAGG + Intergenic
1156721483 18:40075543-40075565 CTGTAATCATTGCTGGATATTGG + Intergenic
1158675405 18:59513574-59513596 CTGTCTTCCTTGATGGAACTAGG - Intronic
1160118934 18:76109597-76109619 CTGTATTTAGTGAGAGAAATAGG + Intergenic
1161465555 19:4428414-4428436 CTGTTTTGAGTGATGGAAATAGG - Intronic
1165680782 19:37773030-37773052 AAGTATTAAGTGATGGAAAATGG - Intronic
1167969488 19:53179002-53179024 CTGAATTCAGTGCTGAAATTAGG - Intronic
925557666 2:5149785-5149807 TTGGATTTAGTGATGCAAATAGG - Intergenic
926952415 2:18257339-18257361 CTGAATTTAGTGTTGGAACTTGG - Intronic
927111058 2:19863976-19863998 CTGGCTTCAGGGATGGGAATCGG - Intergenic
927496847 2:23556841-23556863 TTGTATTCACGGGTGGAAATAGG - Intronic
928082012 2:28320055-28320077 ATGAATTGAGTGGTGGAAATCGG - Intronic
928444789 2:31323601-31323623 CTGTATTCAATCATGGAGATTGG + Intergenic
930202885 2:48561366-48561388 CTGACTTCCGAGATGGAAATCGG - Intronic
931882329 2:66580810-66580832 CTGTAATCAATCATTGAAATAGG - Intergenic
932338917 2:70947480-70947502 CTGTAGTCTGTGATTCAAATTGG + Intronic
934564957 2:95333743-95333765 CTGCGTTCAGTGAGGGAATTGGG - Intronic
936274249 2:111079738-111079760 CTGCATTCAGTGAAAGAGATGGG + Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
938902297 2:135808523-135808545 CCGTTTTCGGTGATGTAAATGGG + Exonic
942977431 2:182035180-182035202 CTCTATTCAATGATGGGGATGGG - Intronic
943886223 2:193219543-193219565 CTTTATTCAGTGAAGAAAATTGG + Intergenic
946403658 2:219481872-219481894 CTCTAATCAGTGATGGAGTTGGG + Intronic
947033103 2:225820435-225820457 CTGTGTTCTGGGATGGAACTAGG + Intergenic
1169956450 20:11108340-11108362 TTGTATTAAGTAATGGGAATTGG + Intergenic
1170153087 20:13245791-13245813 CTGTTTTGAGTCATGGAAAGGGG - Intronic
1173946559 20:46955814-46955836 CTGTACTCAGTGATCAACATAGG - Intronic
1174976262 20:55338943-55338965 CTGTGTTAAGTCATTGAAATAGG + Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1177800359 21:25822853-25822875 CTGTTTTCATTGATGAAAACTGG + Intergenic
1177862929 21:26476098-26476120 GTGAATTCAGTGATGCAAATGGG + Intronic
1178002553 21:28178722-28178744 CTCTTTTCAGCTATGGAAATGGG + Intergenic
1179444622 21:41422545-41422567 CTGAGTTCAGGGATGGCAATGGG + Intronic
1180022542 21:45137602-45137624 CTGCGTTCAGTGATGGAGCTTGG + Intronic
1183143624 22:35969001-35969023 CTGAATTCAGTACTGCAAATGGG + Intronic
951722183 3:25712060-25712082 GTGTCTACAGTGATGGAAAGGGG + Intergenic
954821154 3:53328898-53328920 CTGTAATCAGTGAAGGAGAAAGG - Intronic
954940841 3:54371602-54371624 CTTACTTGAGTGATGGAAATTGG - Intronic
955227863 3:57075840-57075862 GTTTATTCAGTTATGAAAATGGG - Intronic
956479149 3:69655622-69655644 CTGTATTCAGTCCTAGAAGTAGG - Intergenic
957229057 3:77487910-77487932 CTGTATTCAGTCATTGAAAATGG - Intronic
958747947 3:98160502-98160524 CAGTATTCAGTGAAGGAAAAAGG - Intergenic
958758745 3:98281588-98281610 TAGTATTCAGTGAAGGAAAAAGG - Intergenic
959938365 3:112054226-112054248 CTCTAGTCAGTGATGGTGATAGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961550532 3:127668396-127668418 CCGTGTTCAGTGAAGGAAAGGGG - Intronic
962423819 3:135251326-135251348 CTGAGTTCAGGGATAGAAATGGG + Intronic
962786392 3:138771996-138772018 CTGTATTCAGGTTTGTAAATAGG - Intronic
965681320 3:171254625-171254647 CTTCATCCAGTAATGGAAATTGG - Intronic
966281127 3:178230540-178230562 CTGTTTTGAGGGATGGAACTGGG + Intergenic
966971323 3:185048122-185048144 CCGTATGAAGTGATGGACATGGG + Intronic
967787676 3:193514936-193514958 CTGATTTTAGTGATGGAAATGGG + Intronic
969969919 4:11035832-11035854 ATGTATTCAGTGAGAGAAATTGG + Intergenic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
970173563 4:13313481-13313503 CTGTATTTAGTGGGAGAAATAGG - Intergenic
971196411 4:24474643-24474665 TTCTATTCAGTTATCGAAATTGG + Intergenic
972176377 4:36411779-36411801 CTGTATTGAGTGATACAATTAGG + Intergenic
972391519 4:38618076-38618098 TTGTATTCAATGATGGTGATAGG - Intergenic
973632740 4:52834679-52834701 CTGCAGTCAGTGGTGGAACTGGG + Intergenic
974507079 4:62789598-62789620 TTGTATTTAATGAAGGAAATAGG + Intergenic
974545458 4:63300377-63300399 CTATATGAAGTGAAGGAAATTGG + Intergenic
975184929 4:71390278-71390300 CTGTTTTTAGTGAGTGAAATGGG + Intronic
975911740 4:79275282-79275304 CTGTATTCAGAGACAGAACTTGG - Intronic
976124202 4:81816173-81816195 CTGTATGTAGTCATAGAAATAGG - Intronic
977755102 4:100660558-100660580 CGCTAATCAGTGATGGAACTTGG - Intronic
978700245 4:111634630-111634652 ATTTATTCAGTGATGGCAAAAGG - Intergenic
978706098 4:111713572-111713594 CTGCATTCAGGGATGGAAAAGGG + Intergenic
980712972 4:136594303-136594325 ATATATCCAGTGATGAAAATGGG - Intergenic
981205163 4:142032358-142032380 TTGGATTCTGTAATGGAAATGGG - Intronic
983435879 4:167714590-167714612 CTGTCTTCAGTGAATGACATTGG + Intergenic
984513845 4:180713881-180713903 CTGTATTCATGAACGGAAATGGG - Intergenic
986185735 5:5435504-5435526 AAGTATTTAGTGATGGAAAAAGG + Intronic
986303648 5:6499377-6499399 CTGTATGCTGTTTTGGAAATTGG - Intergenic
986320011 5:6622945-6622967 TTGTCTTCAGTGATGGTGATTGG - Intronic
987112782 5:14702400-14702422 CTGTATTTGGAGCTGGAAATAGG + Intergenic
988492166 5:31714135-31714157 CAGGCATCAGTGATGGAAATAGG + Intronic
989491857 5:42065392-42065414 CTGTTTTCAGGGCTGGATATTGG + Intergenic
989603740 5:43224202-43224224 TTGTATTCAGTGATGAAAATAGG - Intronic
990715577 5:58632806-58632828 CTGTATTCAGTCATGGAGAGAGG - Intronic
991310009 5:65228354-65228376 CTATACTAAGTGATGAAAATGGG + Intronic
991510671 5:67373519-67373541 CTTTATTTATTGATGGAAAGAGG - Intergenic
992112914 5:73512981-73513003 GTGGCTTCAGTGAAGGAAATGGG - Intergenic
996611750 5:125390505-125390527 CTGTGTGGAGTGATGTAAATGGG + Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998925337 5:147117608-147117630 ATTTATTCATTGATGGAAATAGG + Intergenic
999916417 5:156267543-156267565 CTGTGCTCAGGGAGGGAAATTGG - Intronic
1001165858 5:169366201-169366223 CCATAGTCAGTGGTGGAAATGGG - Intergenic
1003266135 6:4566221-4566243 CTGTGTGCAGTGATGGAGAGTGG + Intergenic
1003283064 6:4710866-4710888 CTGTATTGAATGCTGGAAATTGG + Intronic
1005597829 6:27396303-27396325 TTGTATTCAGTGATTCTAATAGG - Intronic
1006016545 6:31085795-31085817 CTGTTTTCAGAGAAGGATATGGG + Intergenic
1008142417 6:47847009-47847031 TTGTATTCTGTGGTGAAAATTGG + Intergenic
1008159918 6:48064507-48064529 TTGTATACAGTAATAGAAATGGG - Intronic
1009244081 6:61213579-61213601 CTGCCTTCAGTGGTGGAAGTCGG + Intergenic
1011868852 6:91866958-91866980 CTTTGGTCAGTGAGGGAAATGGG + Intergenic
1013995481 6:116303348-116303370 TTGTATTAAGTGCTGCAAATGGG - Intronic
1017006056 6:150028766-150028788 CTGAAATCAGGAATGGAAATGGG + Intergenic
1018217288 6:161541141-161541163 CTTTCTGCAGTGATGAAAATGGG + Intronic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1021083529 7:16391689-16391711 CATTCTGCAGTGATGGAAATAGG - Intronic
1022205365 7:28158570-28158592 CTTTATTCGGTTGTGGAAATAGG - Intronic
1022636814 7:32144006-32144028 CTGAATTGAGAGATGGAGATGGG + Intronic
1022761805 7:33363744-33363766 CTGTAATCAGGAATGGATATTGG + Intronic
1023243801 7:38178661-38178683 CGGGATTCAGGGATGGATATAGG + Intronic
1027786433 7:82584883-82584905 CAGTACTCAATGATGCAAATTGG - Intergenic
1027902869 7:84140518-84140540 CTGTATTCATTGATGGCTTTAGG + Intronic
1029376791 7:100182430-100182452 AAGTATTAAGGGATGGAAATAGG + Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1031049322 7:116929141-116929163 CGGTAATCTGTGGTGGAAATTGG + Intergenic
1032253950 7:130282321-130282343 CTAGATTCACTGAGGGAAATTGG - Intronic
1035530215 8:345366-345388 CTGGAGGCTGTGATGGAAATGGG + Intergenic
1038083746 8:24171181-24171203 CTGTATTCATGGCTGGAAACAGG + Intergenic
1038180406 8:25222085-25222107 CTGTTTTCTGTGAAGGAAAAAGG + Intronic
1039201990 8:35105236-35105258 CTGTATTCATTGAGGAAAACAGG + Intergenic
1041202879 8:55468082-55468104 CTGTCTTCTGTGATGGAAACTGG - Intronic
1041380649 8:57251246-57251268 CTTTTTGCATTGATGGAAATGGG - Intergenic
1044881709 8:96729970-96729992 TTGTATTTAGTGTTGAAAATGGG + Intronic
1045409881 8:101906215-101906237 CTGTAAGAAGTGAGGGAAATGGG - Intronic
1045808064 8:106188924-106188946 GTATAGACAGTGATGGAAATTGG - Intergenic
1046824503 8:118672576-118672598 CTTCATACACTGATGGAAATTGG - Intergenic
1047179869 8:122576779-122576801 CTGGATTCAGAGATGGAAGGGGG - Intergenic
1048536902 8:135305014-135305036 ATGTGTTTAGTGATGGAAAACGG - Intergenic
1051169719 9:14308207-14308229 CGGTATACAGTGAGGGAAAGTGG + Intronic
1051652175 9:19338859-19338881 GTGTAATAAGTGATGGAAAATGG + Intronic
1052113290 9:24616898-24616920 CTGTATTCAGTCATGTTAATTGG + Intergenic
1052366523 9:27617931-27617953 ATGTCTCCAGTGAAGGAAATGGG - Intergenic
1052639067 9:31141244-31141266 CAGTATTTAGTAATGGAAAAAGG - Intergenic
1055708458 9:79033637-79033659 TTTTATTAAGTGATGGAAAAAGG + Intergenic
1056907859 9:90669577-90669599 CTGGTTTGAGTGATGGAATTGGG + Intergenic
1056995728 9:91456154-91456176 ATGTATCCATTGATGGACATAGG + Intergenic
1058898256 9:109418629-109418651 CTTTCTGCAGTGATGGGAATGGG + Intronic
1058924057 9:109644172-109644194 CTATATTAAGTGATGTAGATTGG - Intronic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1061403709 9:130382393-130382415 CTGTACTCAGAGGTTGAAATTGG + Intronic
1061579141 9:131526215-131526237 CTGTCTTCTGTGATGGAATGGGG - Intronic
1062377443 9:136268554-136268576 CTGTTCTGAGTGATGGAAAAAGG + Intergenic
1187832965 X:23401244-23401266 CTGGAATGAGTAATGGAAATGGG - Exonic
1188274570 X:28183709-28183731 CTGTAGTCAGTCATGTCAATGGG + Intergenic
1189540079 X:41977975-41977997 CTTTCTTCACTGAAGGAAATAGG - Intergenic
1191240388 X:58185627-58185649 CTATATTTAGTGATAAAAATTGG + Intergenic
1192248672 X:69393077-69393099 CAGTTTTCAGTGATGGACAAAGG + Intergenic
1193021577 X:76798480-76798502 CTGCATTCATTGATGGTTATGGG + Intergenic
1194947307 X:100084347-100084369 CATTATTCAGTGGTGGAACTGGG - Intergenic
1196318523 X:114259568-114259590 ATGTACTCAGTAATGGCAATAGG + Intergenic
1196348153 X:114692795-114692817 GTGTATTTTGAGATGGAAATGGG - Intronic
1196900841 X:120381328-120381350 AGGTATTCAGGGATGGAAAGAGG + Exonic
1197129048 X:122982757-122982779 ATGTACTCAGGGTTGGAAATGGG - Intergenic
1198766422 X:140084528-140084550 GTGTCGTCAGTGAGGGAAATGGG + Intergenic
1199427075 X:147715106-147715128 CTGTATTCAGTGAGTGAACATGG - Intergenic
1200489811 Y:3811126-3811148 ATGTCTTCAGTGGTGGAAAAGGG - Intergenic
1202065335 Y:20933534-20933556 CTGTATTCAGTTAGGAAAAGAGG + Intergenic