ID: 1020391721

View in Genome Browser
Species Human (GRCh38)
Location 7:7665671-7665693
Sequence CAGAGGGAACAAAGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10995
Summary {0: 1, 1: 0, 2: 57, 3: 930, 4: 10007}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020391721_1020391727 -4 Left 1020391721 7:7665671-7665693 CCCTCCTTCCTTTGTTCCCTCTG 0: 1
1: 0
2: 57
3: 930
4: 10007
Right 1020391727 7:7665690-7665712 TCTGTGTTCCTCCCCTCCCCAGG 0: 1
1: 0
2: 8
3: 59
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020391721 Original CRISPR CAGAGGGAACAAAGGAAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr