ID: 1020405469

View in Genome Browser
Species Human (GRCh38)
Location 7:7828605-7828627
Sequence GGCTAAGGGGCTGCCTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020405459_1020405469 27 Left 1020405459 7:7828555-7828577 CCCATCCCTGCTGACTTCTGTGT 0: 1
1: 0
2: 1
3: 37
4: 468
Right 1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1020405458_1020405469 28 Left 1020405458 7:7828554-7828576 CCCCATCCCTGCTGACTTCTGTG 0: 1
1: 0
2: 5
3: 44
4: 466
Right 1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1020405460_1020405469 26 Left 1020405460 7:7828556-7828578 CCATCCCTGCTGACTTCTGTGTG 0: 1
1: 0
2: 3
3: 54
4: 422
Right 1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1020405462_1020405469 21 Left 1020405462 7:7828561-7828583 CCTGCTGACTTCTGTGTGTACAC 0: 1
1: 0
2: 1
3: 14
4: 198
Right 1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1020405461_1020405469 22 Left 1020405461 7:7828560-7828582 CCCTGCTGACTTCTGTGTGTACA 0: 1
1: 0
2: 1
3: 29
4: 293
Right 1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020405469 Original CRISPR GGCTAAGGGGCTGCCTGTAA AGG Intronic
901174021 1:7285408-7285430 GGCCATGGGGCTGCCTCTATGGG + Intronic
902623309 1:17662832-17662854 GGGGAAGGGTCTGCCTGTGATGG + Intronic
904916369 1:33973333-33973355 GGCCAAGGGGCTTCCTGCACAGG + Intronic
910615931 1:89198324-89198346 GGGTAAGGGGCTGCAAGTGAAGG + Intronic
911091713 1:94022504-94022526 GGCTAAGGGCCTCCCTGAACAGG - Intronic
923638157 1:235722366-235722388 GGCTAAGGGGCTTTCTATAGAGG + Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067477586 10:46577136-46577158 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic
1067617154 10:47764648-47764670 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
1069947603 10:71998658-71998680 GGCTAAGGGCCAGCCTGGCAGGG - Intronic
1070644608 10:78192991-78193013 AGAGAAGGGGCTGCCTGCAAAGG - Intergenic
1072787757 10:98295768-98295790 GGAGGAGGGGCTGCCTGTGATGG - Intergenic
1074634242 10:115295532-115295554 GGCCAAGGGCCTGCCTGGAGAGG + Intronic
1078131605 11:8618608-8618630 GGCTAAGGGGCTGGAAGTGAGGG + Intronic
1078666947 11:13333658-13333680 GGCTAGGGAACTGCCTGTCATGG - Intronic
1083593594 11:63908792-63908814 GGCTCAGGGGCTGTCTGCCAGGG + Intronic
1083762557 11:64826651-64826673 GGCTGAGGGGCTGCCCTTACTGG + Exonic
1084173136 11:67410129-67410151 GGGGAAGGGGCTGCCTGTCTGGG - Intronic
1084744864 11:71163327-71163349 GGCACAGGGTCTGCCTGTAATGG + Intronic
1084910604 11:72385129-72385151 GACTAAGGAGATGCATGTAAGGG - Intronic
1085521636 11:77142634-77142656 GGATATAGGGCTGCCTGGAAGGG + Intronic
1089709829 11:120306805-120306827 GTCTAAGGGACAGCCTGTAGGGG - Intronic
1090213711 11:124941779-124941801 AGCTAAGGGGCTGCTTCTGAGGG + Intergenic
1091019231 11:132083706-132083728 TGCTAAGGGTTTGACTGTAAGGG - Intronic
1091793988 12:3286954-3286976 GGGTAAGGGGCTTCCTGTAGGGG + Intergenic
1093358198 12:18195587-18195609 GGGTAAGGGGCTGCAAGTGAAGG + Intronic
1095097445 12:38156025-38156047 GGCGCAGGGGCTGCCGGGAAGGG - Intergenic
1096872220 12:54600342-54600364 AGGTTAGGGGCTCCCTGTAAGGG + Intergenic
1097198016 12:57254976-57254998 TGCTCAGGGGCTGCCTGGAGGGG - Exonic
1105262769 13:18792010-18792032 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
1108160255 13:47631823-47631845 GACTAAGGGCCTGCATGTACTGG - Intergenic
1115184661 14:30672193-30672215 GGGTAAGAGCTTGCCTGTAAAGG + Intronic
1117674050 14:58138242-58138264 GGCTCTGGGGCTGCCTGAAGGGG - Exonic
1118795245 14:69137702-69137724 GGCAAAGGGGCTTACTGTACTGG - Intronic
1119444153 14:74649478-74649500 TGGTCAGGGGCTGCCTGTAGGGG - Intergenic
1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG + Intronic
1129144563 15:73634748-73634770 GGCTACAGGGCTGCCTGTGGTGG + Intergenic
1130550691 15:84888481-84888503 GGCCGAGGGGAGGCCTGTAAGGG - Intronic
1132803417 16:1765012-1765034 GGCCAAGGAGCTCCCTGAAATGG + Exonic
1133633534 16:7644519-7644541 TGCTAAGGAGCGGCCTGTGAGGG - Intronic
1136188968 16:28604247-28604269 GGGGAAGGGGGTGCCTGTCATGG + Intergenic
1137005016 16:35268073-35268095 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic
1138511449 16:57510767-57510789 GACAAAGGGGCTGCCTGCTAGGG - Intergenic
1140074677 16:71686579-71686601 GGGGAGGGGGCTGACTGTAAAGG - Intronic
1141526770 16:84617110-84617132 GGCTAGGGGGCTGCTTGGAAGGG - Intronic
1145898238 17:28473331-28473353 GGCTTGGGGGCTGCCTGTGGAGG + Exonic
1149166871 17:53762449-53762471 GACTCAAAGGCTGCCTGTAATGG - Intergenic
1149439370 17:56662204-56662226 GGCTGAGGGGCTTCCTTGAATGG - Intergenic
1149492767 17:57096951-57096973 GACTAAGTGGCTGCCAGTATTGG + Intronic
1152169346 17:78733870-78733892 GGCTTAGTGTCTGCCTGTGAAGG + Intronic
1152494372 17:80660782-80660804 GACCAAGGGGCTGCCTGCATTGG - Intronic
1153014756 18:573546-573568 GCCAAATGGGCTGCCTGTGAAGG - Intergenic
1154358746 18:13642075-13642097 GGCTCAGGGACCGCCTGTGACGG - Intronic
1154428670 18:14291697-14291719 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic
1154430945 18:14308042-14308064 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic
1161106132 19:2444948-2444970 GGCCAAGGGGCTGCATGTCCAGG - Intronic
1165273132 19:34727310-34727332 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
1165814789 19:38635150-38635172 GGCTAAGGGGGTGCCCCTCAAGG + Intronic
1167326577 19:48830148-48830170 GGTTAAGGGGCTGCAAGTGAAGG - Intronic
1167529623 19:50007237-50007259 GGCCCAGGGGCTGCATGTTAAGG - Intronic
926306462 2:11640512-11640534 GGCTAAAGGGAGGCCTGGAACGG + Exonic
932340212 2:70958796-70958818 GGCCAAGGCCTTGCCTGTAAAGG + Intronic
933657535 2:84902102-84902124 GCCTAAGAGGCTGCCTGCTATGG + Intronic
933743527 2:85553371-85553393 GGCTGAGGGGCTGCCTTGAGGGG + Exonic
934308803 2:91845355-91845377 GGCCAAGTGGCTGCATGTGAGGG + Intergenic
935731280 2:106066230-106066252 TGCTAAGCGACTGCCTGGAAGGG - Intronic
948405081 2:237711475-237711497 GCCAAAGGTGCTGCCTGCAAGGG - Intronic
1171164329 20:22957171-22957193 GGCAAAGGGGCAGCCTGGAAGGG - Intergenic
1172898462 20:38316857-38316879 GGCCATGGGGATGCCTGAAATGG + Intronic
1173466901 20:43290488-43290510 GGCTAGGGTACTGCCTGTAAAGG - Intergenic
1175237478 20:57524894-57524916 CGCTGAGGGGCTGCCTGGGAGGG - Intronic
1176846096 21:13877726-13877748 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
1176848828 21:13897268-13897290 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
1179322858 21:40309453-40309475 GGAAAAGGAGCAGCCTGTAAAGG - Intronic
1184789284 22:46689333-46689355 GGACAAAGGACTGCCTGTAAAGG + Intronic
950152594 3:10699102-10699124 GGCTTAGGGGCAGCTTGCAAAGG - Intronic
953455297 3:43035978-43036000 GGAAAAGGGGATGCCTGTAGGGG + Intronic
955924578 3:63992872-63992894 ATCTCAGGGGCTGCCTGAAAAGG - Intronic
959062872 3:101632120-101632142 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
959064326 3:101641584-101641606 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
960808933 3:121610199-121610221 GGATAAGGGGCTGGCTCTGAAGG + Intronic
961522272 3:127473652-127473674 GGCTCAGGCCCTGCCTCTAAGGG + Intergenic
962682380 3:137813725-137813747 GGCTATGGGGCTTCCTTTCAGGG + Intergenic
969035584 4:4250836-4250858 TGCTAAGGGGGGGCCAGTAAAGG - Intergenic
972574965 4:40343224-40343246 GGAGAGGGGGCTGCCTGTATTGG + Intronic
977316544 4:95456094-95456116 TGCTGAGTGGCTGCATGTAAAGG + Intronic
978363137 4:107951996-107952018 GGCCAAGGGGTAGCCTGTTATGG - Exonic
983670430 4:170231031-170231053 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic
985309468 4:188581259-188581281 GGCTAAGGGACTGGTAGTAATGG - Intergenic
997254636 5:132418863-132418885 GTCTAAGGGGAGGCCTGAAATGG - Intronic
997412643 5:133702006-133702028 GTTTCAGGGGCTGCCTGTCAAGG - Intergenic
1003076966 6:2990733-2990755 GGGTAAGGGGCTGCGAGTGAAGG - Intronic
1003193184 6:3891923-3891945 AGCTAAGGGTCTGGCTGTAGTGG - Intergenic
1014187624 6:118453872-118453894 GGCAAAGTTGCTACCTGTAAAGG - Intergenic
1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG + Intronic
1021219710 7:17962034-17962056 GGCTGCAAGGCTGCCTGTAATGG - Intergenic
1022785149 7:33631227-33631249 GGCTGAGGGTCTCCCTGGAACGG - Intergenic
1025858798 7:65307369-65307391 AGCTAAGGGGCTTCCTGGGAAGG + Intergenic
1029551702 7:101240046-101240068 GGCTGAGGGGCTGCCTGGAGGGG + Intronic
1034893251 7:154858789-154858811 GGCTAAGGGGCTGCCATTAGAGG - Intronic
1037803027 8:22045282-22045304 GGCTAAGGAGCTGCCTGCCAGGG + Intronic
1040575722 8:48649541-48649563 GCCTGAGGTGCGGCCTGTAAGGG + Intergenic
1042689702 8:71484436-71484458 GGTCAATGGGCTGGCTGTAATGG + Intronic
1044179938 8:89179045-89179067 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic
1044988926 8:97778437-97778459 GGGTAAGGGGCTGCAAGTGAAGG - Intronic
1046337431 8:112808423-112808445 GGGTAAGGGGCTGCAAGTGAAGG - Intronic
1047250312 8:123177394-123177416 GGCAGGGGAGCTGCCTGTAAGGG - Intergenic
1060718446 9:125956522-125956544 GGCCAAGGAGCAGCCTGAAAGGG - Intronic
1187583961 X:20639426-20639448 GGCTGAGAGGCTACCTGTATGGG + Intergenic
1188357432 X:29209531-29209553 AGCCAAGGGGCTGCCTGGCAAGG - Intronic
1188767560 X:34114469-34114491 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic
1190618152 X:52259557-52259579 GACTAAGAGGCTGACTGAAATGG - Intergenic
1191669867 X:63739143-63739165 GCCTAAGGGGTTGGCTGAAAGGG - Intronic
1195108706 X:101624228-101624250 GGCGTGGGGGCTGCCTGGAATGG + Intronic
1201148494 Y:11080956-11080978 GGCACAGGGTCTGCCTGTAATGG + Intergenic
1201642762 Y:16197512-16197534 GGGTAAGGGGCTGCAAGTGAAGG - Intergenic
1201660053 Y:16387809-16387831 GGGTAAGGGGCTGCAAGTGAAGG + Intergenic