ID: 1020406777

View in Genome Browser
Species Human (GRCh38)
Location 7:7844409-7844431
Sequence TAGCAGAGGCATAACTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020406777_1020406781 17 Left 1020406777 7:7844409-7844431 CCTACCTAGTTATGCCTCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1020406781 7:7844449-7844471 TTGTTAGTAGGTCCTCTTAAAGG No data
1020406777_1020406782 25 Left 1020406777 7:7844409-7844431 CCTACCTAGTTATGCCTCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1020406782 7:7844457-7844479 AGGTCCTCTTAAAGGAGCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1020406777_1020406780 5 Left 1020406777 7:7844409-7844431 CCTACCTAGTTATGCCTCTGCTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1020406780 7:7844437-7844459 TTTTATTTTGTATTGTTAGTAGG 0: 1
1: 4
2: 160
3: 445
4: 3907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020406777 Original CRISPR TAGCAGAGGCATAACTAGGT AGG (reversed) Intronic
903076051 1:20767373-20767395 GAGCACAGGCTTAACCAGGTTGG + Intronic
906475184 1:46164774-46164796 TAGCATAAGCAAAACCAGGTAGG - Intronic
907966069 1:59331099-59331121 TGGCAGAGGAATAAATAGGAGGG + Intronic
910623142 1:89277855-89277877 TTGCACAGGCATCACTGGGTTGG + Intergenic
911636052 1:100237569-100237591 TGGCAGAGGCAAAACAAGGCAGG + Intronic
913365488 1:118033444-118033466 TAGAAGAGGCATAATTTGGGAGG - Intronic
913377902 1:118174903-118174925 TAGCAGAGGCTTGACTACCTGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
921977121 1:221215339-221215361 TCTCAGAAGCATGACTAGGTGGG - Intergenic
922768159 1:228166495-228166517 GAGCAGAGGCGTCTCTAGGTGGG + Intronic
1063550519 10:7028648-7028670 TACCAGAGGCATGGCTAGGGAGG + Intergenic
1065413918 10:25463618-25463640 TATCTCAGGCATAACTAGGAAGG + Intronic
1068097978 10:52515874-52515896 TAGCAGAGGCTAAACTAGGATGG + Intergenic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1082809313 11:57469090-57469112 TAGCAGATTGATAACTAGTTAGG - Intronic
1084799034 11:71529163-71529185 AAGCAAATGCATAATTAGGTTGG + Intronic
1086556497 11:88117305-88117327 TAGCAAAAGCATAAAAAGGTTGG + Intronic
1088393457 11:109341547-109341569 TAGCACAGTAGTAACTAGGTTGG + Intergenic
1088984545 11:114893920-114893942 TGGCAAGGGCAGAACTAGGTTGG + Intergenic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091663649 12:2402919-2402941 TAGCAGAGGGTCAAATAGGTAGG - Intronic
1092720333 12:11434686-11434708 GAACAGAGAGATAACTAGGTTGG - Intronic
1093699013 12:22196727-22196749 TGGCAGGGCTATAACTAGGTCGG + Exonic
1094382869 12:29862543-29862565 AAACAGAGGCATAGCTGGGTAGG + Intergenic
1099014401 12:77326598-77326620 TAGCATGGGTACAACTAGGTAGG + Intergenic
1100719452 12:97342308-97342330 TAGCAGAGGCCTAACCAAGATGG + Intergenic
1101290158 12:103360229-103360251 GAGAAGAGCCATAGCTAGGTTGG - Intronic
1102940981 12:116941504-116941526 TAGCAGAAGCATAATTAAGGAGG + Intronic
1108952391 13:56111537-56111559 TAGCAGAGGCTGAAAGAGGTAGG - Intergenic
1114487003 14:23068797-23068819 TAGGAGAGGGGTAACAAGGTGGG - Intronic
1118353596 14:64992089-64992111 TATCAGAGGCATAAAAAGTTGGG - Intronic
1120084523 14:80255021-80255043 GAGCAAAGCCATAACTATGTAGG + Intronic
1127526404 15:59796507-59796529 TAGCTTAGGCATAGCCAGGTGGG - Intergenic
1129931386 15:79413787-79413809 TAGCACAGTCATGACGAGGTTGG - Intronic
1130385764 15:83410276-83410298 AAGAACAGGCATAAATAGGTGGG - Intergenic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1143480943 17:7227029-7227051 TTGGAGAGGCAGAACAAGGTAGG + Intronic
1148718162 17:49730514-49730536 TGACAGAGGCAGAAATAGGTGGG + Intronic
1150904056 17:69318017-69318039 TAGCAGTGGCCTCACTAGATAGG - Intronic
1151168043 17:72221572-72221594 CAGCAGTGACATAACTATGTAGG - Intergenic
1151766646 17:76136546-76136568 TAGCTGAGGCTTAACTGGGAGGG - Exonic
1152151291 17:78603029-78603051 TAGCAGTGCCAAGACTAGGTGGG - Intergenic
1152592045 17:81218501-81218523 TAGCAGAGGGGTAACCAGCTTGG - Intronic
1153231102 18:2936978-2937000 TAGCTGAGGCTAAATTAGGTAGG - Intronic
1153389766 18:4542337-4542359 TACCAGAAGCTTAACTAAGTTGG - Intergenic
1156190218 18:34710490-34710512 TCGCAGTGGCATAACTTGCTGGG + Intronic
1157437631 18:47684221-47684243 TGGCAGAGGAATAACTAGTGAGG - Intergenic
1159105773 18:64000947-64000969 TAGCAGAGGAATAAAAATGTAGG + Intronic
1168472164 19:56648539-56648561 TAGTAGAGGGATGAATAGGTGGG - Intronic
1168655637 19:58125593-58125615 TATCAGAGGCATACCAAGGTTGG + Intergenic
926506787 2:13725885-13725907 TACCAGAGGCATAACCAACTAGG - Intergenic
933429525 2:82157747-82157769 TAGCTCAGGTATAAATAGGTTGG + Intergenic
1169041134 20:2496503-2496525 GAGCAGAGGAATAACAAGCTTGG + Intronic
1173288704 20:41695399-41695421 TAGAAGAGGCAAGACTAGGCTGG - Intergenic
1177652820 21:23980067-23980089 TATTACAGTCATAACTAGGTTGG + Intergenic
1184361305 22:44020506-44020528 AAGCACAGGCAGAACTAGCTGGG - Intronic
1185166812 22:49266438-49266460 GAGCAGAGGCCTCACTAGGTGGG - Intergenic
950754402 3:15161286-15161308 TAGCATAGGCAAAACCAGATTGG - Intergenic
954990025 3:54832708-54832730 TGGCAGAGGAAGAACTAGCTGGG - Intronic
955112478 3:55962654-55962676 TTGCAAAGGCCTTACTAGGTAGG + Intronic
955397461 3:58567203-58567225 CAGCAGAGGCTGAACCAGGTGGG - Exonic
959127181 3:102303943-102303965 TAGCTGACACATAACTAGGTTGG - Intronic
963689259 3:148478306-148478328 TTGCTGAGGCTTAAGTAGGTGGG + Intergenic
965100359 3:164290129-164290151 TAGCAGAAGCAGAAGTAGTTAGG - Intergenic
965617236 3:170607005-170607027 TAGGAGAGGGATAAATAGATAGG + Intronic
968039859 3:195579753-195579775 TGGGAGATGCATAATTAGGTGGG - Intronic
972865898 4:43232172-43232194 TAGCAAAAGGATGACTAGGTGGG + Intergenic
974021515 4:56695304-56695326 CAGCAGAGGCATAACTGGTGAGG + Intergenic
975646837 4:76554157-76554179 TAGGAAAGGCAAAACTAGGGAGG - Intronic
976227788 4:82810058-82810080 GAAGAGAGGCATAACTGGGTAGG + Intergenic
981974368 4:150706377-150706399 TGGCATAGGGAAAACTAGGTAGG + Intronic
982146045 4:152393760-152393782 TAGGAGATGCATTACTTGGTTGG - Intronic
983321798 4:166204241-166204263 TAGCAGCTGCAGCACTAGGTAGG + Intergenic
984247407 4:177291775-177291797 TAACAGAGACATAACTTTGTTGG - Intergenic
985240194 4:187922973-187922995 CAGTAGAGGCATAACCAGGCTGG + Intergenic
988495581 5:31742682-31742704 TTGCAGAGCCATAACTTGCTAGG + Intronic
993048356 5:82894980-82895002 TAGCAGAGGGATGAGTGGGTGGG - Intergenic
994446847 5:99886296-99886318 TTGGAGAGGAATAACTTGGTAGG + Intergenic
995070251 5:107912988-107913010 TATCAGTGGCTTAACTAGGGTGG + Intronic
1004871722 6:19911727-19911749 AAGCAGAGGCATCAATAGTTTGG - Intergenic
1009714607 6:67374530-67374552 AAGCTGAGGAATAATTAGGTAGG - Intergenic
1014245920 6:119068380-119068402 CAGCAGAGGCTTAACCAAGTGGG + Intronic
1020406777 7:7844409-7844431 TAGCAGAGGCATAACTAGGTAGG - Intronic
1024446078 7:49480800-49480822 TAGCAGAGTGATAACTCTGTGGG - Intergenic
1035916672 8:3632180-3632202 TAGCAAAGGCAGAACTACTTTGG + Intronic
1038949329 8:32397082-32397104 TAGGAGATGGATAAATAGGTAGG + Intronic
1038976068 8:32697647-32697669 TAGCACATACATAAATAGGTTGG - Intronic
1042595165 8:70439652-70439674 TAGCAGAGGCATTCCCAGGGTGG + Intergenic
1042816880 8:72887702-72887724 TCCGAGAGGCATAACTAGTTAGG - Intronic
1045495260 8:102702686-102702708 TATCAGAGGCACAACTTGATTGG + Intergenic
1187888832 X:23914418-23914440 TATCATAGGCATAACGGGGTTGG + Intronic
1188429420 X:30089227-30089249 TAGCAGAGGCCAAACTACCTAGG - Intergenic
1190596183 X:52054096-52054118 TTGCAGAGGAATAATTAAGTTGG - Exonic
1190612641 X:52199977-52199999 TTGCAGAGGAATAATTAAGTTGG + Exonic
1194309721 X:92290641-92290663 AAACAGTGGCATAACTAAGTGGG + Intronic
1198146952 X:133867512-133867534 CAGCAGCTGCATATCTAGGTGGG - Intronic
1200618014 Y:5404909-5404931 AAACAGTGGCATAACTAAGTGGG + Intronic