ID: 1020408748

View in Genome Browser
Species Human (GRCh38)
Location 7:7866853-7866875
Sequence TAGGGTAGTAAAGCTGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020408748 Original CRISPR TAGGGTAGTAAAGCTGTACA TGG Intronic
905031815 1:34889374-34889396 TAGGATAGTAAAGATCAACATGG - Intronic
909014675 1:70369336-70369358 TAGGGTTGTAAAGCTTCTCAGGG - Intronic
909571180 1:77112717-77112739 TAAGGTAGAGAAACTGTACAGGG - Intronic
915877447 1:159626583-159626605 TAGAGAAGTAAATCTGAACAGGG + Intergenic
918414333 1:184291030-184291052 TAGGGCAGGAAAACTGTAGATGG - Intergenic
1068436284 10:56995162-56995184 TAGGGTCCTAAAGCAGCACAGGG - Intergenic
1077873342 11:6281838-6281860 TAGGGTATGAAATCTGGACAGGG + Intergenic
1083370455 11:62174837-62174859 TAGGGTAGTGCAGCTGGGCACGG + Intergenic
1086007715 11:82059167-82059189 TAGGATAGTAACGCAGTGCATGG + Intergenic
1096467761 12:51856744-51856766 TAAGGCCGTAAAGCTGTAAATGG + Intergenic
1099307736 12:80979198-80979220 TAGAATAGTAAAGCTGTACCAGG - Intronic
1099702028 12:86096785-86096807 TAGGGTAATAGAACTTTACAAGG - Intronic
1101002284 12:100368553-100368575 TAGGGTAATAAAGTTGGATAAGG - Intronic
1106564171 13:30870975-30870997 TGGGGTAGTGAAGCTGCACTGGG + Intergenic
1110048007 13:70855674-70855696 TAAGGTATTAAATCTCTACAGGG + Intergenic
1110495360 13:76161738-76161760 CAGTGTAGTAAAGCTGTTGAAGG - Intergenic
1111216856 13:85154735-85154757 GGGGGTAGTAAAGTTGAACACGG - Intergenic
1114580275 14:23751302-23751324 TTGGGTAATAAAGCTGGACCTGG + Intergenic
1117445280 14:55798349-55798371 TAGGGTTGAAAATCTGCACAGGG + Intergenic
1118999301 14:70866776-70866798 CAGGGTAGGAACCCTGTACAGGG + Intergenic
1120265219 14:82240010-82240032 TAGGGTGGTACAGCTGGAAATGG + Intergenic
1133558614 16:6928962-6928984 TTGGGAAGTAAAGATGTTCACGG + Intronic
1137831788 16:51550749-51550771 TAGGGTAGGAGAGTTGTAAATGG + Intergenic
1155450801 18:25960683-25960705 CAGGGCAGTAATGCTGTACCTGG - Intergenic
1156225763 18:35105403-35105425 TAGGGTAGTAAAACTATACTGGG + Intronic
1156259667 18:35433175-35433197 TAAGGTGGTATAGGTGTACAGGG + Intergenic
1164030935 19:21403732-21403754 TAGGGAAGTAAAGGTTTGCAAGG - Intronic
1166956381 19:46468205-46468227 TGGGGGAGAAAAGCTGAACATGG + Exonic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
936619241 2:114077702-114077724 TAGAATACTAAAGCTGTAAACGG - Intergenic
941990429 2:171550696-171550718 TAGGGTAGTTAAGTTGCTCAGGG + Intronic
943036467 2:182752081-182752103 TCTGGTAGTAAAGCTCGACATGG - Exonic
943491156 2:188557923-188557945 TAGTGTTGTGAAGCTGTTCAGGG + Intronic
946361024 2:219219403-219219425 AAGGGTTATCAAGCTGTACACGG + Exonic
946466892 2:219919941-219919963 TAGGGTAGGAAGGCTGTGTAAGG + Intergenic
1169140261 20:3223720-3223742 TTGGGTGGTAAAGCTGTACTTGG + Exonic
1170012067 20:11735169-11735191 TAGGGTTGTCAAGTTGTAAAAGG + Intergenic
1172832015 20:37844013-37844035 TAGGGTAGAAAAGATGGAAACGG - Intronic
952495723 3:33914183-33914205 TAAGGTAGTAAACCTTTGCAGGG - Intergenic
956041310 3:65148237-65148259 TAGGGGATTGAAGCAGTACATGG + Intergenic
956107854 3:65840253-65840275 TAGGGTAGTAAGGCAAGACAAGG - Intronic
962968592 3:140377928-140377950 TAAAGTGGTAAACCTGTACAGGG - Intronic
966465879 3:180230946-180230968 CAGGTTAGAAAACCTGTACAGGG - Intergenic
966677431 3:182604492-182604514 TAGGATATTAAAGGTGTATAGGG - Intergenic
971014083 4:22469511-22469533 TAGGGACTTAAAGCTGTAGATGG - Intronic
976364663 4:84220112-84220134 TAGGGTCCTAAAGCTTTTCAGGG + Intergenic
978522772 4:109633890-109633912 TTAGGAAGAAAAGCTGTACATGG - Intronic
978631772 4:110755706-110755728 TAGTGTAGTGAAGATCTACAGGG - Intergenic
981670208 4:147278151-147278173 GAGAGTATTTAAGCTGTACAGGG - Intergenic
982112181 4:152066876-152066898 CAGGGTAGGACAGCTCTACAGGG - Intergenic
982606667 4:157524513-157524535 CAGGTTAGGAAACCTGTACAGGG + Intergenic
984342530 4:178475678-178475700 TATGGTCATAATGCTGTACAGGG - Intergenic
995358232 5:111264064-111264086 TTGGGTAGCAAAACTGTCCACGG - Intronic
996127409 5:119742221-119742243 TGGGGGACTGAAGCTGTACAAGG + Intergenic
997026345 5:130066612-130066634 TAGGTTAGTAAAGCTTTACTTGG + Intronic
1010102778 6:72128853-72128875 TACGGTAGTAAAGCTACAGAAGG - Intronic
1015183962 6:130392118-130392140 GAGGGTAGGTAATCTGTACAAGG - Intronic
1016256117 6:142107609-142107631 TACTGTAGTAAATCTGTATATGG - Intergenic
1017800361 6:157890202-157890224 GAGTGTAGGAAAGCTGCACATGG - Intronic
1020408748 7:7866853-7866875 TAGGGTAGTAAAGCTGTACATGG + Intronic
1025920207 7:65904515-65904537 TAAGGTTCTTAAGCTGTACATGG + Intronic
1032656634 7:133937516-133937538 TAGGGTGTTAAATATGTACATGG - Intronic
1041327467 8:56683873-56683895 TAAGGAACTAAATCTGTACATGG + Intergenic
1043626032 8:82259686-82259708 TAGTAAAATAAAGCTGTACAAGG - Intergenic
1047910783 8:129527012-129527034 TTAGGTTGTAAAGCTATACATGG + Intergenic
1054881274 9:70147516-70147538 TAGTGTACTAAAGTTGTAAAGGG - Intronic
1057948096 9:99347502-99347524 TTGGGTAGAAATGCTGTAGAAGG - Intergenic
1185981861 X:4788737-4788759 TGGGGTAGTACAGCCCTACAAGG - Intergenic
1188001366 X:24985601-24985623 TAGGATATTCAACCTGTACAAGG - Intronic
1193485602 X:82082103-82082125 TAGGTTAGGAACGCTGTACGGGG + Intergenic
1196462503 X:115944956-115944978 TAGGGTTGGAAACCTGTCCATGG - Intergenic