ID: 1020408886

View in Genome Browser
Species Human (GRCh38)
Location 7:7868132-7868154
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020408883_1020408886 -4 Left 1020408883 7:7868113-7868135 CCTACTGGGAAAATATGAGCTGC 0: 1
1: 0
2: 2
3: 9
4: 152
Right 1020408886 7:7868132-7868154 CTGCCTGGACAGCTTACGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr