ID: 1020409669

View in Genome Browser
Species Human (GRCh38)
Location 7:7877047-7877069
Sequence GTGTTTAAGGGGTCTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020409669 Original CRISPR GTGTTTAAGGGGTCTGTGGG TGG Intronic
900406211 1:2494151-2494173 GTTTTGGAGGTGTCTGTGGGAGG + Intronic
900726015 1:4216755-4216777 GGGTTTAATGGGTCTGGGCGTGG - Intergenic
902801329 1:18831974-18831996 GGGCTCAAGGGGTCTGAGGGAGG - Intergenic
903441507 1:23391425-23391447 GTTATTAGGGGGTCTTTGGGAGG + Intronic
904343396 1:29852556-29852578 GTCTTCATGGGGTCTGTGTGGGG + Intergenic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
906489397 1:46256248-46256270 TTGTGTACGGGGTGTGTGGGGGG + Intronic
912490133 1:110058166-110058188 GTGTCTTAGGGGTGTGTGGGAGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914687211 1:149991221-149991243 GTGTTTGTGGGGTTGGTGGGAGG - Intronic
915342863 1:155185754-155185776 GTGTGTGAGGGGGCTGGGGGAGG - Intronic
915518870 1:156429865-156429887 GTGATTAAGTGGTGTGTGGAGGG + Intronic
915995876 1:160562898-160562920 GTTTTTAATGGGGCTGTGTGTGG - Intronic
916209820 1:162351421-162351443 ATGTGTAATCGGTCTGTGGGTGG - Intronic
917414772 1:174797511-174797533 GTGTGTAGGGGGTGTGTGTGTGG + Intronic
919756854 1:201071383-201071405 GTGTCTCTGGGGTCTGTGGCAGG - Intronic
920440651 1:205978539-205978561 GTGTTTGAGGGGTGGATGGGTGG + Exonic
923665863 1:235998016-235998038 CTGTTTGAGGAGTCAGTGGGAGG + Intronic
923687965 1:236167003-236167025 GAGCTTCAGGGGGCTGTGGGAGG + Intronic
924395622 1:243617152-243617174 GTGTTGAAGAAGTCGGTGGGTGG - Intronic
1063249958 10:4263795-4263817 CTGGTTAAGGGGTCTGTGGGAGG - Intergenic
1067868882 10:49939240-49939262 GTGTTTAAAGGGTATGAGGAAGG - Intronic
1067964219 10:50890482-50890504 GTGTTTGGTGGGTGTGTGGGTGG + Intergenic
1069022368 10:63503256-63503278 GTTTTTTAGGGGTTTTTGGGGGG + Intergenic
1070840872 10:79487079-79487101 GTGTTTGGGGGGACTGTGGAGGG + Intergenic
1072603943 10:96961684-96961706 GTGTGTAAGGGGACTAGGGGTGG + Intronic
1075952259 10:126490448-126490470 GTGTTTAATGGATGTATGGGTGG + Intronic
1076521787 10:131085762-131085784 GTGTGCAGGGGGACTGTGGGAGG - Intergenic
1076719702 10:132387668-132387690 GTGTATTTGGGGTCTCTGGGTGG + Intergenic
1076901101 10:133338175-133338197 GTGTGTCAGGGGTGTGTGTGAGG - Intronic
1077093658 11:790354-790376 GTGGGTGAGGGGTCGGTGGGTGG + Intergenic
1078557387 11:12341023-12341045 CTGTGTAAGGAGCCTGTGGGAGG + Intronic
1079132951 11:17760108-17760130 ATTTTTAAGGGTTCTGTGGTAGG - Intronic
1079184401 11:18223020-18223042 GAGTATATGGGGTGTGTGGGGGG + Intronic
1080623606 11:34008400-34008422 GAGTTTAAGGGGTCTGTCCAAGG - Intergenic
1081365563 11:42230826-42230848 GTGGGTAAGGGGTCTGTGAGAGG + Intergenic
1083200182 11:61116387-61116409 GTGTGTGTGGGGTCTGTGTGGGG - Intronic
1084403882 11:68960116-68960138 GTGTTGGAGGGGCCTGTGGGGGG - Intergenic
1085852790 11:80141123-80141145 GTGGTAAAGGGCTCTGAGGGTGG - Intergenic
1090045690 11:123330848-123330870 GAAGTTAAGAGGTCTGTGGGAGG - Intergenic
1090611630 11:128476286-128476308 GTGGGTTAGGGGTATGTGGGAGG - Intronic
1091028481 11:132162341-132162363 GTGTTTGTGGGGCATGTGGGGGG + Intronic
1091215378 11:133898313-133898335 GTTTGTAAGGGGTCTGGGGGAGG + Intergenic
1092550302 12:9491478-9491500 GTGAATGAGGAGTCTGTGGGAGG + Intergenic
1092603711 12:10096184-10096206 GAGTTTAAGGGGTCTGCAGAAGG - Intronic
1094521510 12:31194893-31194915 GTGAATGAGGAGTCTGTGGGAGG - Intergenic
1094743292 12:33314192-33314214 GTGTTTAAGGGTACTTTGGTGGG + Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095503427 12:42866276-42866298 GGGTTTGAGGGGACTTTGGGGGG - Intergenic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1097688341 12:62711673-62711695 GTGTTTGAAGGGTCTGAGGGGGG + Intronic
1098208795 12:68140450-68140472 GTGTTTCATGGTTGTGTGGGTGG - Intergenic
1103420862 12:120781000-120781022 CTATATAAGGGGTCTGTGGCTGG + Intronic
1104557818 12:129817785-129817807 GTGGTTTGGGGGTGTGTGGGGGG + Intronic
1104665532 12:130644888-130644910 CTGCTTAAGGGGCCTGTGTGGGG - Intronic
1105273045 13:18895421-18895443 GAGTTCAAGGACTCTGTGGGTGG - Intergenic
1105437945 13:20392521-20392543 GTGTTTGACGGGTGTGTGTGAGG - Intergenic
1106654866 13:31732410-31732432 GGAGTGAAGGGGTCTGTGGGAGG - Intergenic
1107452303 13:40521018-40521040 GTCTTGAAGGGGTGTCTGGGTGG - Intergenic
1110947197 13:81437103-81437125 AGGTTTAAGGGGTCTGAGGCTGG + Intergenic
1112985698 13:105446633-105446655 CTTTTTTAGGGGTGTGTGGGGGG + Intergenic
1113040828 13:106102234-106102256 GTGTTCAGGGGGTCTGAGGAAGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1117628511 14:57665143-57665165 GTCTTTAAGGTGTGTGTGTGCGG - Intronic
1118767431 14:68919302-68919324 GTGGTTCAGGGGTCAGTGGCAGG - Intronic
1119909104 14:78333712-78333734 GTGGTTGAGGTGTGTGTGGGGGG + Intronic
1120978391 14:90269598-90269620 GTGTTTAAGTGTGCTTTGGGAGG + Exonic
1121010596 14:90517946-90517968 GTGTTTAGGGAGACAGTGGGCGG + Intergenic
1121126360 14:91409419-91409441 GTGTTTTGGGGGTCTGAGGCAGG - Intronic
1122209930 14:100167387-100167409 GTGTGTTGGGGGCCTGTGGGGGG - Intergenic
1122979810 14:105186409-105186431 GTGTGTATGGGGTGTGTGTGTGG + Intergenic
1122979850 14:105186545-105186567 GTGTGTATGGGGTGTGTGTGTGG + Intergenic
1122979890 14:105186681-105186703 GTGTGTATGGGGTGTGTGTGTGG + Intergenic
1122979907 14:105186737-105186759 GTGTATAGGGGGTGTGTGGGAGG + Intergenic
1122979959 14:105186947-105186969 GTGTGTAGGGGGTATGTGTGTGG + Intergenic
1122979973 14:105186996-105187018 GTGTATAGGGGGTGTGTGGGAGG + Intergenic
1122980009 14:105187120-105187142 GTGTATAGGGGGTGTGTGTGTGG + Intergenic
1124344806 15:28915057-28915079 GTGTATATGGGGTATGTGTGTGG - Intronic
1124344839 15:28915281-28915303 GTGTATATGGGGTATGTGTGTGG - Intronic
1124517068 15:30375578-30375600 GTGTGTAAGTGGTGTGTGTGAGG + Intronic
1124517074 15:30375644-30375666 GTGTGTAAGTGGTGTGTGTGAGG + Intronic
1124531018 15:30506514-30506536 GTGTATATGGGGACTGTGTGTGG + Intergenic
1124725844 15:32155073-32155095 GTGTGTAAGTGGTGTGTGTGAGG - Intronic
1124725850 15:32155139-32155161 GTGTGTAAGTGGTGTGTGTGAGG - Intronic
1124767637 15:32501181-32501203 GTGTATATGGGGACTGTGTGTGG - Intergenic
1124962312 15:34408178-34408200 GTGTGTATGGGGTATGTGTGTGG - Intronic
1124978936 15:34554400-34554422 GTGTGTATGGGGTATGTGTGTGG - Intronic
1127678865 15:61273170-61273192 GTGCCTAAGGGATCTTTGGGAGG - Intergenic
1129797831 15:78391540-78391562 GAGTTTAAGGGGGTTGGGGGTGG + Intergenic
1129858158 15:78839826-78839848 GTTATTAAGGGGGCTGGGGGAGG + Intronic
1130625501 15:85510000-85510022 GTGTTTGAGAAGACTGTGGGAGG + Intronic
1131439601 15:92448922-92448944 CTGTTTATAGGGTATGTGGGGGG + Intronic
1132945262 16:2528740-2528762 GGGTTTAGGTGGTCTGTGAGTGG + Intronic
1133454103 16:5928002-5928024 GTGTTTTAGTGATCTGTGGCAGG + Intergenic
1133475706 16:6119744-6119766 GTGTTTCAGGAGGCTGAGGGAGG - Intronic
1136115024 16:28089052-28089074 GTGTGTGGGGGGTGTGTGGGGGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137006205 16:35276244-35276266 GTGTGTATGGAGTCTGAGGGAGG + Intergenic
1138945170 16:61840762-61840784 GTCTTTCAGGGGTCAGAGGGAGG + Intronic
1138973620 16:62176047-62176069 GTTTTTTAGTGGTCTCTGGGAGG - Intergenic
1141675752 16:85516332-85516354 GAGTTCAAGGGGGCGGTGGGCGG + Intergenic
1143058094 17:4177465-4177487 GTGTAGAGTGGGTCTGTGGGTGG - Intronic
1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG + Intronic
1146928559 17:36762034-36762056 TTCTTTAAGGGGGCTGGGGGTGG + Intergenic
1148339632 17:46865567-46865589 GTGGTTTTGAGGTCTGTGGGTGG + Intronic
1149444446 17:56702929-56702951 GTGTTTGTGAGGTTTGTGGGAGG + Intergenic
1149458601 17:56809568-56809590 GTGTGTGAGGGGTGTGTGTGAGG - Intronic
1149458604 17:56809581-56809603 GTGTGTGAGGGGTGTGTGTGAGG - Intronic
1149458632 17:56809791-56809813 ATGTGTAAGGGGTGTGTGAGGGG - Intronic
1149458672 17:56810038-56810060 GTGTGTGAGGGGTGTGTGTGAGG - Intronic
1149458697 17:56810163-56810185 GTGTTCAAGGAGTGTGTGTGAGG - Intronic
1149458728 17:56810405-56810427 GTGTGTGAGGGGTGTGTGTGAGG - Intronic
1150291529 17:63985095-63985117 GTGTGGGAGGGGTCAGTGGGGGG + Intergenic
1152012509 17:77727103-77727125 GGGTCTAAGGAGTCTGCGGGGGG + Intergenic
1152695667 17:81792898-81792920 GTGTTTGTGGGGTGTGTGTGTGG - Intergenic
1152695707 17:81793201-81793223 GTGTTTGTGGGGTGTGTGTGGGG - Intergenic
1159736162 18:72100504-72100526 GTGTTGAAGGCCTCTGTGGGAGG + Intergenic
1159913457 18:74167557-74167579 GTGTAAAAGGGGTCTCTTGGTGG + Intergenic
1162743266 19:12785405-12785427 GTGTAAAAGAGGTCTGTGGCTGG - Intronic
1164205670 19:23056618-23056640 GTGTTTAATATATCTGTGGGAGG + Intergenic
1164586808 19:29480835-29480857 GTGTTTATGGGGTGGGTGAGTGG - Intergenic
1167432088 19:49461005-49461027 CTGTGGAAGGAGTCTGTGGGAGG + Intronic
1168308314 19:55448315-55448337 GTGTTTGTGTGGTCTGTGGGTGG - Intergenic
927100500 2:19784221-19784243 GTGTGTATGGGGTGTGTGTGTGG - Intergenic
927100507 2:19784291-19784313 GTGTGTATGGGGTATGTGTGTGG - Intergenic
929969394 2:46560983-46561005 GTGTTTATGGGGTCTATAGTAGG - Intronic
931174650 2:59841334-59841356 GCCTTTAAGGGGTTAGTGGGTGG - Intergenic
931451512 2:62370900-62370922 GTGTTTAAGGCCTATGTGGCAGG + Intergenic
931618958 2:64190593-64190615 GTGTTTGTGGTGTCTGTGTGTGG - Intergenic
932312785 2:70757272-70757294 GTGGATAAGGGATTTGTGGGGGG + Intronic
932422965 2:71612238-71612260 GTGCTTTTGGGGTGTGTGGGGGG + Intronic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
933206737 2:79514801-79514823 GTGTTTAAGGAGTATGTGTGAGG + Intronic
933702447 2:85265095-85265117 GTGTTTAATGGGTAAGTGGGTGG + Intronic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934768672 2:96894624-96894646 GTGGGTGGGGGGTCTGTGGGGGG - Intronic
934768714 2:96894748-96894770 ATGGGTAGGGGGTCTGTGGGGGG - Intronic
935600380 2:104916397-104916419 GTGGTTCAGGGGTCTGGGTGTGG + Intergenic
936815063 2:116450407-116450429 GTCTTTAATGGAACTGTGGGAGG + Intergenic
936948417 2:117952274-117952296 GTGTTTCATCGGTCTGTGTGTGG - Intronic
939997506 2:148933451-148933473 GTGTTTACGATGTATGTGGGGGG - Intronic
941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG + Intronic
943504909 2:188742907-188742929 GTGCTTTATGGGTCTGTGTGTGG - Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
945571189 2:211469895-211469917 GTGTTTAAGTGGGCTTGGGGGGG + Intronic
946187640 2:217990129-217990151 GTGTTTTGAGGGTCTGTGGCTGG - Intronic
946187690 2:217990445-217990467 GTGTTTGAAGGGTGTGTGGCTGG - Intronic
947888927 2:233598545-233598567 GTGTTTAAGGAGTCTCTTGGTGG - Intergenic
947894910 2:233661341-233661363 GTGTTTAAGGAGTCTCCTGGTGG - Intronic
948784787 2:240346733-240346755 GTGTGTGTGGGGTCTGTGTGTGG - Intergenic
1168901583 20:1369490-1369512 GGGTTTAAGGGGAGGGTGGGTGG + Exonic
1169257703 20:4111428-4111450 GTGTTTGGGGGGCCTGGGGGAGG - Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1173825272 20:46044025-46044047 CTGTGTGAGGGGCCTGTGGGAGG + Intronic
1174137956 20:48393419-48393441 GTGGTGATGGGGTCTGTGGACGG + Intergenic
1175656957 20:60779301-60779323 GTGTTGAAGGGTTCATTGGGAGG + Intergenic
1176122507 20:63460449-63460471 CTGTCTCAGGGGGCTGTGGGGGG - Intronic
1176372424 21:6070306-6070328 GTGTGTATGGTGTGTGTGGGAGG + Intergenic
1179751094 21:43468233-43468255 GTGTGTATGGTGTGTGTGGGAGG - Intergenic
1183176430 22:36227816-36227838 GTGATGAAGGAGTTTGTGGGTGG - Exonic
950920332 3:16687689-16687711 CTTTTTAAAGGGTCTGTAGGAGG - Intergenic
951599779 3:24360891-24360913 GTGCTTAATTGGTCTGTGGTGGG + Intronic
955808832 3:62764488-62764510 GTGTAAAAGGAGTCTGTGGTTGG + Intronic
957320264 3:78621100-78621122 GTTTTTAAAGTGTCTGTGTGTGG + Intronic
959935717 3:112026314-112026336 GTGTTTGTGGGCCCTGTGGGAGG + Intergenic
964225261 3:154391302-154391324 GTGTGTGGGGGGTTTGTGGGGGG + Intronic
967106562 3:186259307-186259329 CTGGTAAAGGTGTCTGTGGGGGG + Intronic
967816451 3:193803033-193803055 GGGTTTAAGGGGTGTGAAGGAGG - Intergenic
972271478 4:37514597-37514619 TTGTTTCAGGAGTCTGTGGGGGG - Intronic
977135476 4:93298500-93298522 GTGCTAAAAGGGTCTTTGGGAGG - Intronic
978398867 4:108310579-108310601 GTGTTTAACAGCTCAGTGGGGGG - Intergenic
979041513 4:115803204-115803226 GTGGTTAAGGGGGCAGTTGGGGG + Intergenic
979327342 4:119395277-119395299 GTGATGAATGGGTTTGTGGGGGG - Intergenic
979928417 4:126597425-126597447 GTGTATAAGGGGTGTGTGAAGGG + Intergenic
980500230 4:133641402-133641424 GTATTTAAAGGGTCTGTGCCTGG + Intergenic
981921059 4:150085233-150085255 CTGTTTGTGGGGTCTTTGGGAGG + Intronic
981947300 4:150362758-150362780 GTGTTTGAGAGAACTGTGGGTGG - Intronic
983245225 4:165279965-165279987 GTGATGAATGGGTTTGTGGGGGG - Intronic
983963576 4:173783515-173783537 GTGATTAAGAGGTCTGAGTGAGG - Intergenic
984522317 4:180816741-180816763 GTGCTTCAGGGTACTGTGGGAGG - Intergenic
984777428 4:183494337-183494359 GGGTTTAAGGCTTTTGTGGGAGG + Intergenic
984888919 4:184474306-184474328 ATGTTTCTGGGGACTGTGGGGGG - Intronic
985727587 5:1524088-1524110 GTTTCTCTGGGGTCTGTGGGGGG + Intergenic
985967673 5:3349970-3349992 GTGTTCAAGGTGTGTGTGGAGGG - Intergenic
988527990 5:32003092-32003114 GTGTTTGTGGGGTGTGTGTGTGG - Intronic
988528035 5:32003423-32003445 GTGTGTAGGGTGTGTGTGGGGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989642750 5:43599467-43599489 GGGTTTTGGGGGTCTTTGGGGGG - Intergenic
992383134 5:76258152-76258174 GTGTGTAAGGAGTTTGTTGGAGG + Intronic
993693511 5:91032288-91032310 GAGTTTAAGAAGGCTGTGGGAGG + Intronic
995277801 5:110296881-110296903 GTGTGTATGGGGGCTGTTGGGGG + Intronic
995759575 5:115549307-115549329 ATTTTTAAGGGGTCTGTAGGGGG + Intergenic
996443157 5:123513086-123513108 GTGTTTAAGGGGTTGGGTGGGGG + Intronic
997821099 5:137066778-137066800 GTGTTTAAAGGCTCTTTAGGAGG - Intronic
1001085227 5:168695675-168695697 GTGTTTGGGGGGTAGGTGGGTGG + Intronic
1002068742 5:176665843-176665865 AGGTCTAAGGGGTCAGTGGGCGG + Intergenic
1002136605 5:177111736-177111758 GTGTTTCAGGGGCCTGAGGAGGG + Intergenic
1002346000 5:178547774-178547796 GTGTGTGGGGGGTGTGTGGGGGG - Intronic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1005526844 6:26659651-26659673 CTGTTAAAGCGCTCTGTGGGCGG - Exonic
1006948449 6:37801222-37801244 TTGTTTAAGGAGTCGGTGGAGGG - Intergenic
1007018408 6:38493397-38493419 GTGCTGACGGGGTCTTTGGGAGG + Intronic
1007723836 6:43902322-43902344 GTCTTTAAGGGTTCTTTGGTGGG - Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1013895311 6:115081054-115081076 GTGTGTAGCGGGTCTGTGTGTGG - Intergenic
1013895361 6:115081573-115081595 GTGTGTAGCGGGTCTGTGTGTGG + Intergenic
1020214514 7:6179623-6179645 GTGTGTGAGGTGTATGTGGGGGG - Intronic
1020409669 7:7877047-7877069 GTGTTTAAGGGGTCTGTGGGTGG + Intronic
1021149645 7:17134095-17134117 GTGTTTGAAAGGCCTGTGGGAGG + Intergenic
1022048164 7:26639631-26639653 GTGTTTGTGGTGTGTGTGGGGGG - Intronic
1024583141 7:50817029-50817051 GTGGTTACGGGGCCTGGGGGTGG + Intergenic
1025927704 7:65972734-65972756 GTGTTTGAGGCTTCTTTGGGAGG - Intronic
1026257854 7:68728001-68728023 ATGTTGAAGGGGTTTGAGGGTGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026793435 7:73350108-73350130 GCTATTAAGGGGTCTGTGGCCGG - Intronic
1027507148 7:79030600-79030622 GTGTTTAAGTAGACAGTGGGTGG + Intronic
1030779642 7:113584307-113584329 TGGTCTAAGGGGTCTGTTGGTGG + Intergenic
1030945126 7:115709460-115709482 GTATTTAATGGGTCTGAGGGGGG - Intergenic
1031601917 7:123720543-123720565 TTGTTTAAAGGTTCTGTGTGTGG + Intronic
1033821515 7:145140393-145140415 ATGTTTAATGGGTCTGTGCTAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034277384 7:149829786-149829808 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277412 7:149829865-149829887 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277550 7:149830319-149830341 GTGACTAAGGGGACTGTGGAGGG - Intergenic
1034277571 7:149830396-149830418 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277659 7:149830701-149830723 GTGACTGAGGGGACTGTGGGAGG - Intergenic
1034277711 7:149830896-149830918 GTGACTGAGGGGACTGTGGGAGG - Intergenic
1034986017 7:155515918-155515940 GGGCCTAAGGGGTCTGGGGGAGG - Intronic
1037634972 8:20693353-20693375 GTGTGTAAGTGGCCTGGGGGAGG + Intergenic
1038229870 8:25689924-25689946 GTGTTTCAGGGGTCTGAGGAAGG - Intergenic
1041721927 8:60983903-60983925 GTGTTGGTGGGGGCTGTGGGAGG - Intergenic
1044048520 8:87469068-87469090 TTATTTTAGGGGTTTGTGGGAGG - Intronic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1045314413 8:101030594-101030616 GTGTTTAGGAGGGCTGTGGTAGG + Intergenic
1047150447 8:122255422-122255444 GTTTTTAAGGTGTCTGTCTGAGG + Intergenic
1048725449 8:137378346-137378368 GAGGCAAAGGGGTCTGTGGGTGG - Intergenic
1049131920 8:140853116-140853138 GTGTTTAAGGTGTGTGTTGGAGG - Intronic
1049543209 8:143217995-143218017 GTGTTGAGGGGGTGTGGGGGTGG - Intergenic
1049666094 8:143843442-143843464 TTGTTGAATGGATCTGTGGGTGG + Intergenic
1050230805 9:3524972-3524994 GTGTGCAAGGGGTGTGTGGGGGG + Intronic
1051671157 9:19512064-19512086 TTGTTAAAGTGGTCTGGGGGTGG + Exonic
1052062906 9:23983061-23983083 GTGTTTTAGGGGCAAGTGGGTGG + Intergenic
1052351589 9:27464493-27464515 GTGTTTGAGGGATTAGTGGGAGG - Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055011119 9:71566601-71566623 GTGTTTAGGGGGGTGGTGGGGGG - Intergenic
1056753967 9:89371094-89371116 GTGTATAAGGTGTGTGTGGGGGG + Intronic
1056753984 9:89371162-89371184 GTGTATAAGGTGTGTGTGGGGGG + Intronic
1056754144 9:89371850-89371872 GTGTCTGAGGTGTGTGTGGGGGG + Intronic
1056754265 9:89372321-89372343 GTGTCTGAGGTGTGTGTGGGGGG + Intronic
1057682293 9:97200056-97200078 CTGTTAAAGCGCTCTGTGGGCGG - Intergenic
1057987351 9:99730627-99730649 GTGTTTTTGGGGTTTGTGTGTGG - Intergenic
1058506448 9:105670845-105670867 GTTTTTAAGCAGTATGTGGGAGG + Intergenic
1059896664 9:118873774-118873796 GTGTGTATGGGATCTTTGGGTGG - Intergenic
1062053325 9:134458320-134458342 GTGGGAAGGGGGTCTGTGGGGGG - Intergenic
1062132630 9:134908071-134908093 GTGTCAAAGGTGACTGTGGGAGG - Intronic
1188632485 X:32382669-32382691 GTGTTGTAGGGGTGTGTGGGGGG + Intronic
1190311973 X:49123125-49123147 GTGTCTGAGGGGTCTGAGGGAGG - Intronic
1190874151 X:54447831-54447853 GTTTTAAGGGGGTATGTGGGTGG + Intronic
1192020254 X:67383203-67383225 GTGTTTTGGGGGTTTTTGGGGGG - Intergenic
1194849264 X:98852312-98852334 GTGCTTAAGGTGTCAGTGGCAGG - Intergenic
1197502522 X:127259717-127259739 GTGTCTAAGGGTACTGGGGGAGG + Intergenic
1197903783 X:131401449-131401471 GTGTGTAGGGGGTGTGTGGGAGG - Intergenic
1198500937 X:137245776-137245798 GTGTTTTAGGGCTCTATGGGCGG + Intergenic