ID: 1020409722

View in Genome Browser
Species Human (GRCh38)
Location 7:7877734-7877756
Sequence ATATTTATTATATGGGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 515}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020409722_1020409729 27 Left 1020409722 7:7877734-7877756 CCTTTCTCCCATATAATAAATAT 0: 1
1: 0
2: 1
3: 34
4: 515
Right 1020409729 7:7877784-7877806 AAGGACTCGATTCCTTCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 77
1020409722_1020409728 8 Left 1020409722 7:7877734-7877756 CCTTTCTCCCATATAATAAATAT 0: 1
1: 0
2: 1
3: 34
4: 515
Right 1020409728 7:7877765-7877787 GGCTATGAAGGTTTTAGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 184
1020409722_1020409727 3 Left 1020409722 7:7877734-7877756 CCTTTCTCCCATATAATAAATAT 0: 1
1: 0
2: 1
3: 34
4: 515
Right 1020409727 7:7877760-7877782 AATTAGGCTATGAAGGTTTTAGG 0: 1
1: 0
2: 3
3: 12
4: 253
1020409722_1020409726 -4 Left 1020409722 7:7877734-7877756 CCTTTCTCCCATATAATAAATAT 0: 1
1: 0
2: 1
3: 34
4: 515
Right 1020409726 7:7877753-7877775 ATATACAAATTAGGCTATGAAGG 0: 1
1: 0
2: 0
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020409722 Original CRISPR ATATTTATTATATGGGAGAA AGG (reversed) Exonic