ID: 1020409722 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:7877734-7877756 |
Sequence | ATATTTATTATATGGGAGAA AGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 551 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 34, 4: 515} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1020409722_1020409729 | 27 | Left | 1020409722 | 7:7877734-7877756 | CCTTTCTCCCATATAATAAATAT | 0: 1 1: 0 2: 1 3: 34 4: 515 |
||
Right | 1020409729 | 7:7877784-7877806 | AAGGACTCGATTCCTTCAGATGG | 0: 1 1: 0 2: 0 3: 10 4: 77 |
||||
1020409722_1020409728 | 8 | Left | 1020409722 | 7:7877734-7877756 | CCTTTCTCCCATATAATAAATAT | 0: 1 1: 0 2: 1 3: 34 4: 515 |
||
Right | 1020409728 | 7:7877765-7877787 | GGCTATGAAGGTTTTAGGAAAGG | 0: 1 1: 0 2: 0 3: 7 4: 184 |
||||
1020409722_1020409727 | 3 | Left | 1020409722 | 7:7877734-7877756 | CCTTTCTCCCATATAATAAATAT | 0: 1 1: 0 2: 1 3: 34 4: 515 |
||
Right | 1020409727 | 7:7877760-7877782 | AATTAGGCTATGAAGGTTTTAGG | 0: 1 1: 0 2: 3 3: 12 4: 253 |
||||
1020409722_1020409726 | -4 | Left | 1020409722 | 7:7877734-7877756 | CCTTTCTCCCATATAATAAATAT | 0: 1 1: 0 2: 1 3: 34 4: 515 |
||
Right | 1020409726 | 7:7877753-7877775 | ATATACAAATTAGGCTATGAAGG | 0: 1 1: 0 2: 0 3: 15 4: 201 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1020409722 | Original CRISPR | ATATTTATTATATGGGAGAA AGG (reversed) | Exonic | ||