ID: 1020409723

View in Genome Browser
Species Human (GRCh38)
Location 7:7877741-7877763
Sequence AATTTGTATATTTATTATAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1918
Summary {0: 1, 1: 1, 2: 7, 3: 144, 4: 1765}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020409723_1020409727 -4 Left 1020409723 7:7877741-7877763 CCCATATAATAAATATACAAATT 0: 1
1: 1
2: 7
3: 144
4: 1765
Right 1020409727 7:7877760-7877782 AATTAGGCTATGAAGGTTTTAGG 0: 1
1: 0
2: 3
3: 12
4: 253
1020409723_1020409729 20 Left 1020409723 7:7877741-7877763 CCCATATAATAAATATACAAATT 0: 1
1: 1
2: 7
3: 144
4: 1765
Right 1020409729 7:7877784-7877806 AAGGACTCGATTCCTTCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 77
1020409723_1020409728 1 Left 1020409723 7:7877741-7877763 CCCATATAATAAATATACAAATT 0: 1
1: 1
2: 7
3: 144
4: 1765
Right 1020409728 7:7877765-7877787 GGCTATGAAGGTTTTAGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020409723 Original CRISPR AATTTGTATATTTATTATAT GGG (reversed) Exonic