ID: 1020409728

View in Genome Browser
Species Human (GRCh38)
Location 7:7877765-7877787
Sequence GGCTATGAAGGTTTTAGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020409723_1020409728 1 Left 1020409723 7:7877741-7877763 CCCATATAATAAATATACAAATT 0: 1
1: 1
2: 7
3: 144
4: 1765
Right 1020409728 7:7877765-7877787 GGCTATGAAGGTTTTAGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 184
1020409722_1020409728 8 Left 1020409722 7:7877734-7877756 CCTTTCTCCCATATAATAAATAT 0: 1
1: 0
2: 1
3: 34
4: 515
Right 1020409728 7:7877765-7877787 GGCTATGAAGGTTTTAGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 184
1020409724_1020409728 0 Left 1020409724 7:7877742-7877764 CCATATAATAAATATACAAATTA 0: 1
1: 1
2: 8
3: 178
4: 2000
Right 1020409728 7:7877765-7877787 GGCTATGAAGGTTTTAGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020409728 Original CRISPR GGCTATGAAGGTTTTAGGAA AGG Exonic