ID: 1020409728 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:7877765-7877787 |
Sequence | GGCTATGAAGGTTTTAGGAA AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 192 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 184} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1020409723_1020409728 | 1 | Left | 1020409723 | 7:7877741-7877763 | CCCATATAATAAATATACAAATT | 0: 1 1: 1 2: 7 3: 144 4: 1765 |
||
Right | 1020409728 | 7:7877765-7877787 | GGCTATGAAGGTTTTAGGAAAGG | 0: 1 1: 0 2: 0 3: 7 4: 184 |
||||
1020409722_1020409728 | 8 | Left | 1020409722 | 7:7877734-7877756 | CCTTTCTCCCATATAATAAATAT | 0: 1 1: 0 2: 1 3: 34 4: 515 |
||
Right | 1020409728 | 7:7877765-7877787 | GGCTATGAAGGTTTTAGGAAAGG | 0: 1 1: 0 2: 0 3: 7 4: 184 |
||||
1020409724_1020409728 | 0 | Left | 1020409724 | 7:7877742-7877764 | CCATATAATAAATATACAAATTA | 0: 1 1: 1 2: 8 3: 178 4: 2000 |
||
Right | 1020409728 | 7:7877765-7877787 | GGCTATGAAGGTTTTAGGAAAGG | 0: 1 1: 0 2: 0 3: 7 4: 184 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1020409728 | Original CRISPR | GGCTATGAAGGTTTTAGGAA AGG | Exonic | ||