ID: 1020410478

View in Genome Browser
Species Human (GRCh38)
Location 7:7886697-7886719
Sequence CTGGATGTAGGGAGATCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020410478 Original CRISPR CTGGATGTAGGGAGATCAGT TGG (reversed) Intronic
902989468 1:20176312-20176334 CTGGATGTAGGGAAAAAACTGGG + Intronic
903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG + Intronic
903850970 1:26305933-26305955 CTGGAAGTAGGGAAGTCAGTTGG - Intronic
903946433 1:26966786-26966808 CTGGATGAATGGAGATGACTGGG + Intergenic
903965699 1:27087893-27087915 CTTGATGTTGGGAGATCAAGTGG + Intergenic
904064914 1:27741958-27741980 TTGGAGGTAGGGTGATCATTTGG + Intronic
904890443 1:33775628-33775650 CTGAATGGAGGGTCATCAGTAGG + Intronic
905366536 1:37454708-37454730 CTGGGTGTGGGAAGATCAGAGGG - Intergenic
906720261 1:47998871-47998893 TTGGAGGCAGGGAGACCAGTGGG + Intergenic
907342667 1:53747998-53748020 CTGGAGGCAGGGAGACCAATGGG - Intergenic
908718100 1:67091559-67091581 CTGGATGGAGGGAAAACAGGGGG + Intergenic
909212728 1:72845072-72845094 CTGGAGGCAGGGAAACCAGTTGG + Intergenic
909480085 1:76121357-76121379 CTGGAAGCAGGGAGATGAGATGG - Intronic
910789026 1:91031423-91031445 CTGGATGCAGAGAGAAGAGTAGG + Intergenic
912701744 1:111882953-111882975 CTGGAAGTAGGAAGACAAGTTGG - Intronic
913355464 1:117916545-117916567 ATGGATGTAAGGAGACCAGCTGG + Intronic
913457666 1:119049896-119049918 GTGGAAGCAGGGAGACCAGTTGG - Intronic
915037738 1:152942823-152942845 ATGGAGGCAGGGAGACCAGTTGG - Intergenic
916003669 1:160639655-160639677 ATGAATGCAGGGAGATCAGCTGG - Intronic
916989057 1:170222635-170222657 GTGGTCTTAGGGAGATCAGTTGG - Intergenic
918854556 1:189734154-189734176 CTGGATTTAGGGAGTTCAAGGGG - Intergenic
918905917 1:190493460-190493482 CTGCATGTAAGTAGATAAGTCGG - Intergenic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
920216570 1:204365324-204365346 CTGGAGGCAGGAAGATCAGTTGG + Intronic
921014565 1:211176623-211176645 CTGGAGACAGGGAGACCAGTTGG + Intergenic
921148289 1:212379635-212379657 CTGGTTCTAGAGAGATCATTTGG - Intronic
921245091 1:213229864-213229886 ATGGAAGCAGGGAGATCAGTTGG + Intronic
921442188 1:215200627-215200649 CTGGATTCAGGAAAATCAGTTGG + Intronic
921635926 1:217493147-217493169 CTGGAAGCAGGGAGATCATTTGG - Intronic
922222116 1:223616540-223616562 CTGGAGGAAGGGAGATCTCTGGG + Intronic
923548280 1:234940838-234940860 CTGGATGTTGGGGGATGACTGGG - Intergenic
1063478934 10:6353983-6354005 CTGAATGGATTGAGATCAGTTGG + Intergenic
1066193114 10:33074063-33074085 CTGGATGAAGGGACACCACTGGG + Intergenic
1067878086 10:50021712-50021734 CTGAGTGTTGGGAGAGCAGTGGG + Intergenic
1071813183 10:89205803-89205825 CTGGGTGTAGGGTGTTCTGTTGG - Exonic
1072238332 10:93472334-93472356 CAGGATCTATGGAGAACAGTAGG + Intronic
1072960862 10:99927796-99927818 CTGGTTTCAGGGAGATCAGAGGG + Intronic
1073337629 10:102722028-102722050 CGGGATGCAGGGAGACCAGCTGG - Intronic
1074365521 10:112854750-112854772 CAGTATGTAGGGAGAGCAATCGG + Intergenic
1074870213 10:117570191-117570213 CTGGCTGCAGAGAGCTCAGTGGG + Intergenic
1074957901 10:118410533-118410555 CTGGAGGTTGGGTCATCAGTTGG + Intergenic
1076169050 10:128304915-128304937 CTGGGTGTAGGGAGAGCTATGGG - Intergenic
1078657977 11:13260218-13260240 CTGCATGGAGGGAGAGCAGCAGG + Intergenic
1079309756 11:19354809-19354831 CTGGCTGTGGGAAGATCAGGAGG + Intronic
1080535554 11:33218130-33218152 ATGGAAGCAGGGAGATTAGTTGG + Intergenic
1082858750 11:57833428-57833450 TTGGAGGTAGGGAAATCAGCTGG + Intergenic
1083727802 11:64637424-64637446 CTGGAGGTGGGGAGCCCAGTAGG + Intronic
1084721531 11:70908831-70908853 CTAAATGGAGGTAGATCAGTTGG - Intronic
1087666263 11:101052652-101052674 CTGGAGTTAGGGAGGACAGTTGG + Intronic
1088096444 11:106106134-106106156 CTGGAAGTAGGGAGTCCATTGGG - Intergenic
1088888795 11:114028824-114028846 CTGGATGTAAGGAGGACAGTGGG - Intergenic
1088912765 11:114204550-114204572 ATGGGTGTAGGGAGAACACTGGG - Intronic
1089041056 11:115450327-115450349 CTGGAAGTAGAAAGATAAGTAGG - Intronic
1089043991 11:115483045-115483067 CTGGATTTACTGACATCAGTTGG - Intronic
1089083537 11:115797758-115797780 CTGGAGGCAGGGAGGTCAGCTGG + Intergenic
1090609017 11:128453541-128453563 GTGGAGGCAGGGAGACCAGTTGG - Intergenic
1091449306 12:562592-562614 CTGGAGGCAGGGAGAGGAGTGGG + Exonic
1091916293 12:4273536-4273558 CTGGATGGAGGGAGAGGGGTGGG + Intergenic
1095246872 12:39933335-39933357 ATGGATGCAGGAAGACCAGTTGG + Intronic
1095714085 12:45322610-45322632 CTGGATGCAAGGAGACCAGTGGG + Intronic
1096106951 12:49001660-49001682 CTGGATGGTGGGAGAACAGCAGG - Intergenic
1096192288 12:49627754-49627776 GTGGATGTGGGGAAAACAGTTGG + Intronic
1098591786 12:72222757-72222779 GTGGTCCTAGGGAGATCAGTGGG + Intronic
1098788708 12:74792847-74792869 CTGGATGTGGGGTTATCAGTAGG - Intergenic
1098999054 12:77155487-77155509 CTGCTGGTAGGGAGCTCAGTTGG - Intergenic
1100453206 12:94727493-94727515 CTTGATGTGGGGAGATCATCTGG - Intergenic
1100891487 12:99131159-99131181 CTGGATGTTGGGAGAGCAGGTGG - Intronic
1102402139 12:112638969-112638991 TTGGTTTTAGGGAGATCAGATGG + Intronic
1102487264 12:113266754-113266776 CTGGGTGTAGGGACATCTGCGGG - Intronic
1102501092 12:113353012-113353034 CTGGATTTAGAGGTATCAGTAGG - Intronic
1104065298 12:125300476-125300498 CTGGATGTAGGCAGATAGGTAGG - Intronic
1107092303 13:36495091-36495113 CTGGAGGTGGGAAGACCAGTTGG + Intergenic
1107685073 13:42888921-42888943 CTTGATGTAGGGAGATAGATTGG + Intronic
1107982730 13:45748911-45748933 CTGAATTGAGGGAGATCATTTGG - Intergenic
1108614969 13:52123852-52123874 CTTGATGCTGGGAGATCAGCAGG + Intronic
1109178903 13:59189552-59189574 GTGGATGCATGGAGATCTGTGGG - Intergenic
1110362926 13:74648197-74648219 CTGGATGGAGGGAGATAAGCTGG - Intergenic
1110634285 13:77747671-77747693 CTAGATGTCAGGAGATCAGAGGG - Intronic
1111708874 13:91785884-91785906 GTGGAAGTAGGGAGAGTAGTTGG - Intronic
1112323677 13:98429309-98429331 TTGGATGCAGGGCGGTCAGTGGG + Intronic
1113924588 13:113934406-113934428 CAGGATGGATGGAGATGAGTCGG + Intergenic
1116466523 14:45239742-45239764 CTGGAAGCAGGGAGACCACTAGG + Intronic
1118138369 14:63052341-63052363 CAGGAAGAAGGGAGACCAGTTGG - Intronic
1118501275 14:66364832-66364854 ATGAAGGTAGGGAGATAAGTAGG + Intergenic
1118923404 14:70170234-70170256 CGGGATGAAGGGGGATGAGTGGG - Intronic
1119432647 14:74578529-74578551 CTGGATGAGGGGACATGAGTAGG - Intronic
1119474377 14:74918694-74918716 CTGGATGCAAGGAGAACAGCTGG + Intronic
1119651302 14:76385647-76385669 CGGGATGGTGGGAGAGCAGTGGG - Intronic
1122083591 14:99284220-99284242 CTGGGTGCAGGGAGGTCTGTGGG + Intergenic
1122268304 14:100556931-100556953 CAGGTTGGATGGAGATCAGTGGG - Intronic
1122560016 14:102606464-102606486 GTGGATATAGGGAGTTCAGCGGG + Intronic
1123430753 15:20214030-20214052 CTGTATGTAGGGAGAAAATTGGG - Intergenic
1124984321 15:34591501-34591523 GTGGAAGTAGGGAGAGCGGTTGG - Intergenic
1126356415 15:47801180-47801202 CTGGTAGTAGGGAGGCCAGTTGG + Intergenic
1126909445 15:53402457-53402479 ATGGATCTAGGGTGATCAGCTGG + Intergenic
1127979085 15:64021168-64021190 CTGGAAGTAGGCACTTCAGTGGG + Intronic
1128206577 15:65858052-65858074 ATGGAAGCAGGGAGACCAGTTGG - Intronic
1128567679 15:68711922-68711944 CTGGAGGTAGGGGGTGCAGTGGG - Intronic
1129001809 15:72341660-72341682 CTAGGTGAAGGGAGATGAGTTGG + Exonic
1129897097 15:79116534-79116556 ATGAATTTAGGGAGAACAGTGGG + Intergenic
1130449106 15:84033175-84033197 ATGGATGAAGGGGGACCAGTTGG - Intronic
1135347758 16:21703828-21703850 CAGGATGTATGCAAATCAGTTGG + Intronic
1135463538 16:22665553-22665575 CTGTATGTAGGGAGACCATGAGG - Intergenic
1138329410 16:56201555-56201577 CTGGAGGTTGGGAGACCAGATGG + Intronic
1138853056 16:60653603-60653625 CTGGATGCAGGGAAATAAGAAGG + Intergenic
1139120829 16:64014443-64014465 CTGGATGTTGGGAGAAAAGAAGG - Intergenic
1139630165 16:68226442-68226464 CTGGATTTAGGAAGATCTGATGG + Exonic
1141819502 16:86435208-86435230 CTTGATGTAGGCAGAAAAGTCGG + Intergenic
1142857851 17:2742347-2742369 GTGGATGTGGGGAGGTCAGCTGG + Intergenic
1143309553 17:5977240-5977262 CTGGATGCGGGGAGATCAGGTGG + Intronic
1143556949 17:7667963-7667985 CTGGATGGAGAGAGGCCAGTGGG - Intronic
1143858299 17:9869200-9869222 CTGGAGGAGGGGAGATCAGTTGG - Intronic
1146901780 17:36593349-36593371 GGGGAGGTAGGGAGATCAGGTGG + Intronic
1148686086 17:49502040-49502062 CTGGATGGAGGGAGATCGGAGGG - Intronic
1149228291 17:54501169-54501191 CTGGCTGTATGGTGTTCAGTAGG - Intergenic
1149656648 17:58312633-58312655 CTGGAGGGAGGGAGGTCAGGAGG + Exonic
1149771871 17:59328828-59328850 CTGGAAGCAGGGAGATCAGTTGG + Intergenic
1150717814 17:67586852-67586874 CTGGAAGCAGGGAGTCCAGTTGG + Intronic
1152642281 17:81454237-81454259 CAGGATGTGGGGGGATCAGGTGG + Intronic
1153942830 18:9992093-9992115 CTGGATGTGGGGATCTCAGTGGG - Intergenic
1154124128 18:11674477-11674499 CTGGAAGCAGGGAAATCATTTGG + Intergenic
1154406169 18:14093276-14093298 CAGGATGGAGGGGGATGAGTGGG - Intronic
1156360457 18:36380365-36380387 TAGGATGTAGAGAGATCATTGGG + Intronic
1156458593 18:37308518-37308540 CTGGGGGCAGGGAGATCAGCCGG - Intronic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1158135155 18:54199796-54199818 CTAGAAGTAGGGAGAATAGTTGG - Intronic
1158390266 18:57039263-57039285 CTGGATGTTGGTGGAGCAGTTGG + Intergenic
1158810851 18:61032302-61032324 CTGGATGCAGGAAGGTCTGTTGG - Intergenic
1159742101 18:72184742-72184764 GTGGATGGAGGAAGAGCAGTTGG - Intergenic
1160335842 18:78038493-78038515 CTGGATGTAGAGAGAAAAGTGGG + Intergenic
1162929972 19:13952803-13952825 TTGGATGGAGGGGGCTCAGTTGG + Intronic
1163680051 19:18676054-18676076 CTGGATGTAGGGAGGTCAATGGG + Intergenic
1165646466 19:37442621-37442643 GTGGATACAGGGAGATTAGTAGG + Intronic
1167600550 19:50451985-50452007 CTGGCTGAAGGGAGATGAGGTGG + Exonic
925320225 2:2960551-2960573 CTGGACTTGGGGAGATCAGATGG - Intergenic
926016386 2:9455484-9455506 AGGGACATAGGGAGATCAGTGGG + Intronic
926089438 2:10040954-10040976 CTGGAGGGAGGGAGACCTGTTGG + Intergenic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
930884458 2:56308970-56308992 TTGGAGGAAGGGAGATCTGTGGG + Intronic
933647058 2:84821443-84821465 CTGGATGCAGGGGAGTCAGTGGG - Intergenic
936402233 2:112174129-112174151 CTGGAAGTGGGCAGATCACTAGG - Intronic
940258545 2:151757656-151757678 CTGGATTCAGGGAGACGAGTAGG - Intergenic
940754072 2:157661482-157661504 CTGGAGGGAGGAAGATCATTAGG + Intergenic
941203233 2:162540836-162540858 ATGGAAGGAGGGAGACCAGTTGG + Intronic
941860299 2:170272383-170272405 CTGGAAGTAGGGAGACCAGCTGG - Intronic
944075370 2:195723625-195723647 GTGGATGTTGGGATATGAGTGGG + Intronic
945623756 2:212173749-212173771 CTGGATGAAAGGAGGTCAGAGGG + Intronic
946928970 2:224654321-224654343 CTGAATGGAGGGAGACAAGTAGG - Intergenic
948637824 2:239351070-239351092 CTGGAATTAGGAAGATCAGTTGG + Intronic
1168948467 20:1780603-1780625 ATGGAAGCAGGGAGACCAGTGGG + Intergenic
1169900109 20:10544227-10544249 CTGGATGAAGGGAGAGCCTTAGG - Intronic
1171472505 20:25383349-25383371 CTGGATTGACAGAGATCAGTGGG - Intronic
1173582526 20:44157727-44157749 GTTGATGTGGGCAGATCAGTTGG - Intronic
1174118275 20:48242847-48242869 GTGGAAGCAGGGAGATCAGGTGG - Intergenic
1174421885 20:50404662-50404684 CTGGAGGAAGGGAGATAAGGAGG - Intergenic
1175186948 20:57185090-57185112 CTGGAAGCAGGGAGACCAGGTGG + Intronic
1175609383 20:60337843-60337865 CTACATGTCGGGAGATCTGTTGG + Intergenic
1181992329 22:26846993-26847015 CTGGATGTGGGGAGATGGGGAGG - Intergenic
949987648 3:9553121-9553143 CTGAATTTAGGGAGCTCAGAAGG + Intronic
952019053 3:28994930-28994952 CTGGTTGTGGGGAGAGGAGTGGG + Intergenic
952191761 3:31030100-31030122 CTGGATTTATTGAAATCAGTGGG - Intergenic
952531610 3:34268140-34268162 CTGGCTGTAGGGTGATCACCAGG + Intergenic
954383387 3:50231622-50231644 CTGGAATTAGGGATATGAGTGGG + Intronic
954504654 3:51058000-51058022 CTGGATATAGTGAACTCAGTTGG + Intronic
955856196 3:63276695-63276717 CTGCATGTAGGAAGAGCAGTAGG + Intronic
957543308 3:81604350-81604372 CAGGATGTAGTGAGATGAGATGG - Intronic
960736697 3:120788971-120788993 ATGGAAGCAGGGAGACCAGTTGG - Intergenic
961406632 3:126684325-126684347 CTGGATGGAGGGAGAGCAGGTGG + Intergenic
961410555 3:126717232-126717254 CTGGATGAAGGTTAATCAGTAGG + Intronic
962462783 3:135630088-135630110 GCTGATGTAGGGAGATGAGTGGG - Intergenic
964608068 3:158580144-158580166 GTGGAAGTAGGGAGAGCATTAGG + Intronic
966139875 3:176744993-176745015 CTGGATTTAAGCAGGTCAGTTGG - Intergenic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
970505414 4:16724328-16724350 TTGGATGCAGGGAGATTTGTGGG + Intronic
971627913 4:28947290-28947312 CTGGAAGTAGGAAGAACAGATGG + Intergenic
972440042 4:39079194-39079216 GTGGAGGCAGGGAGACCAGTTGG - Intronic
976244948 4:82997609-82997631 TTGGAGGCAGGGAGACCAGTTGG + Intronic
976613452 4:87052693-87052715 GTGGAAGCAGGGAGACCAGTTGG + Intronic
980034747 4:127871023-127871045 GTGGATGTAGGGAAAACAGCAGG + Intergenic
980133537 4:128838804-128838826 CTGGCTGTAGGGAGAGGTGTTGG + Intronic
981843930 4:149145062-149145084 GTGGAAGCATGGAGATCAGTTGG + Intergenic
985797591 5:1974759-1974781 CTGGATGTAGTGAGCAGAGTTGG + Intergenic
987175553 5:15304427-15304449 CTGGATTCAGGGAGAAGAGTTGG + Intergenic
987831998 5:23105970-23105992 CTGGAAATGGGGAGGTCAGTTGG - Intergenic
988127789 5:27063869-27063891 TTGGATTTGGGGATATCAGTCGG + Intronic
992594775 5:78334977-78334999 CAGGAAGCAGGGAGATGAGTTGG - Intergenic
992738553 5:79748776-79748798 CTGGAGGTGGGCAGATCACTTGG - Intronic
993436707 5:87904743-87904765 CAGTAAGTAAGGAGATCAGTTGG + Intergenic
993739060 5:91514604-91514626 CTGGAAGTAGTGAGGTCAGAGGG - Intergenic
993987400 5:94613602-94613624 CTCAATCTAGGGAGGTCAGTAGG + Intronic
994042455 5:95274335-95274357 GTGGATGCAGGGAGGTCTGTAGG - Intronic
995100653 5:108299307-108299329 CTTGAGGTAGGGAGATGGGTGGG - Intronic
996790871 5:127291381-127291403 CTGGATGTAGGGAGATTTGTGGG + Intronic
997235500 5:132269937-132269959 TTGTATGTAGGGAGATTGGTAGG + Intronic
998152694 5:139766060-139766082 CTGGATGAAGGGAGAACATTGGG + Intergenic
998657051 5:144193130-144193152 TTAGTTGTAGGGAGATCAGTGGG - Intronic
999171890 5:149602419-149602441 GTGGAAGCAGCGAGATCAGTTGG + Intronic
999771365 5:154778552-154778574 CTGCATTTATGGAGATCAATGGG + Intronic
1000100300 5:158009829-158009851 CTGGAAGCAGAGAGATCAATTGG - Intergenic
1000208615 5:159088346-159088368 ATTGATGTAGGGCTATCAGTTGG - Intronic
1000231171 5:159316615-159316637 CTGGATGCAGGGATATGATTGGG - Intronic
1002062456 5:176633896-176633918 CTGGCTGTAGAAAGATCAGTAGG + Intronic
1002772305 6:300458-300480 CTGGAGGTAGGGAGCTCACTAGG + Intronic
1005021938 6:21426662-21426684 CTGGAGGTAGGTAGTCCAGTAGG - Intergenic
1006164076 6:32054245-32054267 CTGGAGGCAGGGAGGCCAGTAGG - Intronic
1006817707 6:36864128-36864150 CTGGAAGCAAGGAGACCAGTGGG - Intronic
1012931870 6:105325909-105325931 AAGGAGGCAGGGAGATCAGTTGG + Intronic
1014642737 6:123932932-123932954 ATAAATGTAGGGAGATCTGTTGG - Intronic
1016071490 6:139744533-139744555 CAGTATAAAGGGAGATCAGTAGG - Intergenic
1016881920 6:148920110-148920132 CTGGATGTGGTCTGATCAGTTGG + Intronic
1020410478 7:7886697-7886719 CTGGATGTAGGGAGATCAGTTGG - Intronic
1021389503 7:20074266-20074288 CAGGATGGTGGGAGATTAGTTGG - Intergenic
1022330255 7:29371935-29371957 GTGGAAGCAGGGAGATCAGGTGG - Intronic
1023267770 7:38426034-38426056 TTGGATGTGGGAATATCAGTGGG + Intronic
1027128850 7:75576385-75576407 CTGTATGTTGGGATGTCAGTGGG + Intronic
1027889119 7:83948175-83948197 GTGGAAGTAAGAAGATCAGTGGG - Intergenic
1028167624 7:87556669-87556691 GTGGAAGCAGGGAGACCAGTGGG - Intronic
1028847390 7:95497246-95497268 ATGGAAGCAGGGAGACCAGTAGG + Intronic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1031975442 7:128090661-128090683 CTGGGAGAAGGGAGAGCAGTGGG - Intronic
1034198364 7:149265012-149265034 CTGGAAGTGGGGAAATCAGGTGG + Intronic
1036456550 8:8914192-8914214 CTGGCGGCAGAGAGATCAGTAGG - Intergenic
1036607696 8:10322292-10322314 CTGGATGCAGGGAGATGAGTTGG + Intronic
1037319560 8:17630414-17630436 CTGAGGGTAGGGAGATCTGTTGG + Intronic
1037467591 8:19175086-19175108 CTGGGTGTAGGGAGAAGAGGAGG - Intergenic
1038248442 8:25881107-25881129 TTGGATGCAGGGAGGTCACTTGG - Intronic
1038506322 8:28088169-28088191 GTGGAAGTGGGGAGATCAGGTGG - Intergenic
1041057711 8:54004612-54004634 CTGGAAGGAGGAAGACCAGTTGG + Intronic
1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG + Intronic
1042930602 8:74009514-74009536 CTGGAAATAGGGAGATCATGAGG + Intronic
1046380245 8:113440415-113440437 CTATATGTAGGAAGATCAATAGG - Intergenic
1047448723 8:124943340-124943362 CTGGATGCAGAGAGACCAGCTGG - Intergenic
1047583318 8:126241296-126241318 CTGGATGTAGGGAAGTCAAGTGG - Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048978758 8:139691508-139691530 CTGGCTGTAGTGGGATCAGCAGG - Intronic
1049159373 8:141087506-141087528 GTGAATGTGGGGAGAGCAGTCGG + Intergenic
1049163497 8:141112331-141112353 CTGGAGGAGGAGAGATCAGTAGG + Intergenic
1050986701 9:12091796-12091818 CTGGAGGTAGGGTTTTCAGTAGG + Intergenic
1051757461 9:20418874-20418896 CAGAATGTAAGGAGATCAGAAGG + Intronic
1052395283 9:27930987-27931009 GTGGAAGTAGGAAGATGAGTTGG - Intergenic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1056326588 9:85484895-85484917 TTGGCTCTAGGGAGATCAGCAGG - Intergenic
1056694308 9:88833344-88833366 TTGGAAGTTGGGAGTTCAGTGGG - Intergenic
1057804756 9:98212124-98212146 CTGGAAGTAGGGAGATTGTTTGG - Intronic
1058787767 9:108407087-108407109 CTGCATGTAGGAAGATTACTGGG + Intergenic
1059307831 9:113368505-113368527 CTGGATGCAGGCTGGTCAGTAGG + Intronic
1061921954 9:133787388-133787410 CTGGGGGTGGGGTGATCAGTGGG + Intronic
1062418956 9:136469851-136469873 TTGGATGTAGGGGGACAAGTGGG - Intronic
1186951348 X:14628935-14628957 GTGGATGTAGGGAAACTAGTTGG + Intronic
1190055623 X:47179620-47179642 TTTGATGTAGGGAGAACAGGGGG + Intronic
1190296705 X:49031796-49031818 GTGGCTGTAGTGAGATCAATCGG - Intronic
1194062743 X:89224483-89224505 CTGCATGTACGGAGATCACACGG - Intergenic
1195704690 X:107730376-107730398 CTGTATGAAGGGAGTTCAGTGGG - Intronic
1195799665 X:108693613-108693635 CTCGAGGTAGAGAGACCAGTTGG + Intronic
1196036976 X:111156082-111156104 CTGGATGAAGGGAGACTAGTAGG + Intronic
1200716611 Y:6553462-6553484 CTGCATGTACGGAGATCACACGG - Intergenic
1201562195 Y:15329964-15329986 TTGGATGAAGGGAGAGCAGGAGG - Intergenic