ID: 1020413770

View in Genome Browser
Species Human (GRCh38)
Location 7:7922619-7922641
Sequence ATTGCTATGCAGATTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020413770 Original CRISPR ATTGCTATGCAGATTGTTGA TGG Intronic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
904624644 1:31795573-31795595 ATTGCCATTCAGTTTGTTCAGGG + Intronic
908051739 1:60240154-60240176 ATTCCTAAGCAAAGTGTTGAAGG - Intergenic
911124002 1:94323270-94323292 AGTGCTGGGCACATTGTTGAAGG + Intergenic
911596289 1:99801986-99802008 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
912278840 1:108291048-108291070 ATTTCTAGGCAAAGTGTTGAAGG - Intergenic
912289386 1:108403309-108403331 ATTTCTAGGCAAAGTGTTGAAGG + Intronic
914327767 1:146637022-146637044 ATGGCTATAAAGATTTTTGATGG + Intergenic
916303971 1:163307993-163308015 ATTAGGATGCAGATTGTTCATGG - Intronic
916387949 1:164298322-164298344 AGTGCAATGCAGATTGATGGAGG + Intergenic
916669279 1:166998317-166998339 AATGATATTCAGATTGTTAATGG - Intronic
918500646 1:185191668-185191690 ATTACTTTGGAGTTTGTTGAAGG + Intronic
920161387 1:204000854-204000876 ATTTCTAAGCAGAGTATTGAAGG + Intergenic
920933937 1:210413551-210413573 ATTTCTAAGCAAAGTGTTGAAGG - Intronic
921727406 1:218539047-218539069 ATAGCTAAGCAAAGTGTTGAGGG + Intergenic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
923953478 1:238988170-238988192 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
924143596 1:241050955-241050977 ATTTATTTGCAGATTTTTGATGG + Intronic
924429151 1:243981893-243981915 ATTGCTATGAGAATTCTTGACGG - Intergenic
1063767517 10:9159764-9159786 ATTGCTATAAAGATTCCTGAAGG + Intergenic
1065068128 10:21993553-21993575 ATTGCTATTAAAAATGTTGAGGG - Intronic
1065079855 10:22117787-22117809 AATGCTATGCAGATTAGTGGTGG - Intergenic
1068703159 10:60041831-60041853 ACTGGTATGCAGAGTGCTGAGGG - Intronic
1071076104 10:81754841-81754863 ATTGCCACGCATATTATTGAAGG - Intergenic
1071548605 10:86548332-86548354 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1072002339 10:91209021-91209043 ATTTATAGGCAGATTGTTGTTGG + Intronic
1072590701 10:96826328-96826350 ATTGCTCGACAGATTGTTGATGG - Intergenic
1072769653 10:98126866-98126888 ATTGTTATACTGATTGTTTAGGG + Intergenic
1078397550 11:10994615-10994637 ATTTCCAGGCAGAGTGTTGAAGG - Intergenic
1078579906 11:12531022-12531044 AATTGTATGCAGATTGATGAAGG + Intergenic
1080810847 11:35702616-35702638 GTTGCCATGCATATTGTAGATGG + Intronic
1087380071 11:97394215-97394237 ATTTCTGTGAAGATTGTTGTTGG + Intergenic
1087422152 11:97943110-97943132 ATTTCTAAGCAGAGTTTTGAAGG + Intergenic
1087521206 11:99239478-99239500 ATTGCTTTTAAAATTGTTGAAGG + Intronic
1087965906 11:104414614-104414636 ATATATATGCAAATTGTTGATGG + Intergenic
1089987375 11:122826422-122826444 ATTGCTAGGCAGGTGGGTGAGGG - Intergenic
1094277529 12:28695115-28695137 ATTGCTATGGAGAATGTTAAAGG + Intergenic
1095239644 12:39841879-39841901 GTAGCTATGAAGATTTTTGAGGG + Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096964508 12:55614953-55614975 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
1099778386 12:87163559-87163581 ATTTCTAAGCAGAGTGTTGAAGG - Intergenic
1099788504 12:87298869-87298891 ATTGCTTTGTAGATTGGTGGTGG - Intergenic
1101700402 12:107168560-107168582 GTTGCTGTGGGGATTGTTGAAGG + Intergenic
1103882835 12:124179591-124179613 ATTTCTAAGCAAAGTGTTGAAGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106344360 13:28861326-28861348 ATTGCTCTGCATGTAGTTGAAGG + Intronic
1106433812 13:29706597-29706619 ATTGCTTTGCATCTTGTTTATGG - Intergenic
1106451667 13:29887964-29887986 ATTCTTAGGCAGATTTTTGACGG - Intergenic
1108729606 13:53220673-53220695 ATTTTTATGCAAAGTGTTGAAGG - Intergenic
1108839400 13:54593501-54593523 ATGGCTATGCAGTTGGTTGGGGG - Intergenic
1109403609 13:61868665-61868687 AATGCTATGCAGAATGTCAATGG + Intergenic
1111758915 13:92436566-92436588 ATTACAATTCAGATTGTGGAAGG - Intronic
1111840608 13:93445569-93445591 TTTGCTCTGCAGATTGCTGCAGG - Intronic
1114574602 14:23700662-23700684 ATCTCTAGGCAGAGTGTTGAGGG + Intergenic
1114908074 14:27155136-27155158 ATTGGTGTGCAGATTTTTGTGGG + Intergenic
1115050056 14:29048467-29048489 ATTGATATATAGATTGTAGATGG - Intergenic
1116586025 14:46705777-46705799 ATGGATATGCAGAGTGTTAAAGG + Intergenic
1118477900 14:66135383-66135405 ATGACTATGAAGATTGTTCATGG + Intergenic
1120557827 14:85951570-85951592 ATTATTATGCAGATTGATAAAGG + Intergenic
1120910409 14:89661434-89661456 ATTGCAATGGAGATTGTAAATGG - Intergenic
1121881244 14:97502290-97502312 ATTTCTAAGCAAAATGTTGAAGG + Intergenic
1122285244 14:100647691-100647713 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1202892395 14_KI270722v1_random:170514-170536 CTTCCTATGCAGATCGGTGAGGG - Intergenic
1127450255 15:59109613-59109635 ATTTGTATGCAGAATATTGATGG + Intronic
1127580172 15:60331141-60331163 ATTGCTGTGCAAATTTTTGTGGG - Intergenic
1130861263 15:87893025-87893047 ATTACTTTGAAGATTTTTGATGG + Intronic
1131456320 15:92585202-92585224 ATCGCTGTGCAGAATGTTGGTGG - Intergenic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1132138583 15:99368936-99368958 ATTTCTAAGCAAAGTGTTGAAGG - Intronic
1134653510 16:15929110-15929132 ATTGCTATGCAGTTTATCCAAGG - Intergenic
1136779875 16:32891194-32891216 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1136890740 16:33970323-33970345 ATTTCTATGCAAAGTGTGGATGG + Intergenic
1137897512 16:52229796-52229818 ATTTGGATGCAGATAGTTGATGG + Intergenic
1140005792 16:71073915-71073937 ATGGCTATAAAGATTTTTGATGG - Intronic
1203082293 16_KI270728v1_random:1153283-1153305 ATTTCTATGCAAAGTGTGGATGG - Intergenic
1149905687 17:60525030-60525052 CTTGCTGTTCAGATTTTTGAGGG + Intronic
1150120426 17:62596716-62596738 CTTGCAATGCTGATTGTTCATGG + Intronic
1153121125 18:1729019-1729041 CAAGCTATGCAGATAGTTGAGGG + Intergenic
1154425373 18:14268068-14268090 ATTGTTATGCGGAATGTTAAAGG + Intergenic
1156694034 18:39745257-39745279 AATGCTATAGAGATTTTTGAGGG + Intergenic
1157537794 18:48473161-48473183 ATTGCTAAGCAAAATGTTAAAGG + Intergenic
1159293098 18:66446913-66446935 ATTGATATTCAGATTTTTCATGG + Intergenic
1162657248 19:12140315-12140337 GTTGCTATGCAGGTTGTTGTCGG - Exonic
1164674952 19:30094798-30094820 ATAGCAAGGCAGATTGTTGTAGG + Intergenic
1164887362 19:31792869-31792891 ATTGCTGTGCAAAATTTTGAGGG - Intergenic
928751813 2:34479401-34479423 ATAGCAATGCAAGTTGTTGATGG + Intergenic
932242094 2:70165373-70165395 ATTGATATGCTGATCATTGAAGG + Intronic
932441123 2:71736281-71736303 ATTAATTTGCTGATTGTTGATGG - Intergenic
933339770 2:81008090-81008112 ATTGCTCTGAAAAGTGTTGATGG - Intergenic
936931510 2:117794440-117794462 ATTGAGGTGCACATTGTTGATGG + Intergenic
937480197 2:122250509-122250531 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
937510351 2:122588346-122588368 ATTTCTAGGCAAAATGTTGAAGG + Intergenic
937639887 2:124199864-124199886 ATCTCTATGTAGATTGTTTAGGG + Intronic
938719711 2:134055640-134055662 ATTGTTATGCATATTTCTGATGG + Intergenic
940514412 2:154663094-154663116 ATTGCTATGCAGTTTATTTCTGG - Intergenic
941101919 2:161306443-161306465 AGTGCTTGGCTGATTGTTGAAGG - Intergenic
941936355 2:170984244-170984266 ATTGTCATGCAAATTCTTGATGG + Intergenic
944389011 2:199197920-199197942 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
946538087 2:220653083-220653105 ATTGCCTAGCAGATTGTTGAAGG + Intergenic
947328444 2:229002903-229002925 ATTTCCAAGCAGAGTGTTGAAGG - Intronic
948405978 2:237719855-237719877 ATTACTATGCAGATTATTTATGG - Intronic
1175086972 20:56468062-56468084 GTTGCCATGCATATTGTAGATGG - Intergenic
1182480509 22:30605892-30605914 ATTGCAATGCAGATTGTGCATGG + Intronic
1182966729 22:34528591-34528613 ATTTCTGTGCATATTGTTTATGG - Intergenic
949372813 3:3353887-3353909 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
951112834 3:18824791-18824813 ATTTCTATGCAAACTGTTCAAGG - Intergenic
952667733 3:35927396-35927418 ACTGCAATGCAGATTGTTTCCGG + Intergenic
953225108 3:41011397-41011419 ATAGCAATGCTGATTGTTGTAGG - Intergenic
956059414 3:65334496-65334518 ATTACTATGGAAATTGATGAAGG - Intergenic
956386560 3:68725479-68725501 AGAGCTATGCAGAGTCTTGATGG - Intergenic
957240914 3:77660277-77660299 ATTTCCAAGCAGAGTGTTGAAGG - Intergenic
957527445 3:81395364-81395386 AATGCTATCCAGGTTATTGACGG - Intergenic
958690379 3:97458484-97458506 ATTGCCATGTTTATTGTTGATGG - Intronic
958723831 3:97878994-97879016 TTTGCCATGAAGATTGTTTAAGG - Intronic
959392343 3:105792044-105792066 ATTGCTATGCTGATGGTCTAAGG - Intronic
961256678 3:125560339-125560361 CTGGCTATGGAGATTGTTAAGGG - Intronic
961491343 3:127258473-127258495 ATTTCTAAGCAGATTCTAGATGG - Intergenic
962115002 3:132495503-132495525 ATTGCTATTCAGATTGCTTTGGG + Intronic
962341705 3:134591176-134591198 ATTATTCTGCAGAATGTTGAAGG + Intergenic
962688181 3:137867429-137867451 ATTGCTAAGCAAAGTGTTGAAGG - Intergenic
963525941 3:146413480-146413502 ATTTCTATGCAAAATATTGAAGG - Intronic
963943819 3:151123174-151123196 CTTGATATGCAGAATGTTTAGGG - Intronic
964362293 3:155911189-155911211 ATTGCTGTGCACATTGATAATGG + Exonic
970164940 4:13226568-13226590 AGAGCTGTGCAGATTGCTGAAGG + Intergenic
970207252 4:13667339-13667361 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
970617193 4:17779619-17779641 GCTGCTATGCTGAATGTTGATGG - Intronic
971486172 4:27162801-27162823 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
971975859 4:33685714-33685736 ACTGCTATGAAGATTATAGAAGG - Intergenic
972184574 4:36513256-36513278 ATTTCTAAGCAAATTATTGAAGG + Intergenic
972490918 4:39586306-39586328 ATTTCTAAGCAAAATGTTGAAGG - Intronic
974664126 4:64936085-64936107 ATTTCTAAGCAAAATGTTGAAGG - Intergenic
979069616 4:116185537-116185559 ATTTCTAAGCAAAATGTTGAAGG + Intergenic
979786655 4:124723191-124723213 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
981548318 4:145916792-145916814 ATTTCTAAGCAAAATGTTGAAGG - Intronic
981826222 4:148944594-148944616 ATTATTATGCAGATTTATGAAGG - Intergenic
983315192 4:166123257-166123279 ATTGCTCTTCTGTTTGTTGATGG + Intergenic
983567649 4:169171398-169171420 AGTGCTAAGCAGATTAATGAGGG + Intronic
983870175 4:172816628-172816650 TTTTCTAGTCAGATTGTTGAAGG - Intronic
983953045 4:173664454-173664476 ATTACTATGCACCTTGTTGAAGG + Intergenic
983968718 4:173845116-173845138 ATTTCCAGGCAGAATGTTGAGGG + Intergenic
984338561 4:178423898-178423920 ATTTCTAAGCAAAATGTTGAAGG - Intergenic
985942137 5:3145282-3145304 ATTTCTAGGCAAAGTGTTGAAGG + Intergenic
987606581 5:20143677-20143699 ATTTCTAAGCAAAGTGTTGAAGG + Intronic
988123134 5:26993342-26993364 ATTTCTAAGAAAATTGTTGAAGG + Intronic
989069193 5:37492696-37492718 ATTTCTAAGCAAAATGTTGAAGG + Intronic
989286745 5:39708828-39708850 CTAGCTATGCATATTTTTGAAGG - Intergenic
992647471 5:78825201-78825223 ATCGCTTTCCAAATTGTTGATGG - Intronic
993579791 5:89646052-89646074 ATTGCTTTGCATATAATTGAAGG - Intergenic
993767616 5:91880335-91880357 GTTGCTATGCCAATTGTTTAAGG - Intergenic
993919850 5:93788170-93788192 ATTACTATTAACATTGTTGATGG + Intronic
994668143 5:102732176-102732198 ATTGCTGTGAAGATTCATGAAGG - Intergenic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
997793010 5:136779477-136779499 ATTGGTATCCAGATTGTTGTTGG - Intergenic
1000408017 5:160909117-160909139 ATTGCAATGCAGTGTGATGAAGG + Intergenic
1002974395 6:2059848-2059870 ATTACTATGCAAATTTTTGGGGG - Intronic
1005012924 6:21353058-21353080 GTGGCTATGCAGAATATTGAAGG + Intergenic
1005855191 6:29855634-29855656 ATTTCTCTACAGATTGTGGAAGG - Intergenic
1007878580 6:45135485-45135507 ATTTCTATGCAAAATATTGAAGG - Intronic
1010240361 6:73609929-73609951 ATTGCTCTAGAGATTGTTGGTGG + Intronic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1011896242 6:92229613-92229635 AATACTATGCAAATTGGTGAGGG - Intergenic
1014385493 6:120796360-120796382 ATTGCTATTTAGATTGTTAGTGG - Intergenic
1014650713 6:124033589-124033611 ATTGATGACCAGATTGTTGATGG + Intronic
1014775696 6:125507202-125507224 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1014781199 6:125566773-125566795 ATTTCTATGGAGATTATTTAAGG + Intergenic
1014783258 6:125588620-125588642 ATTGCTTTCCACATTGTTGAAGG + Intergenic
1015148731 6:130016561-130016583 ATGGCTAAGCTGATTCTTGAAGG - Intronic
1015206286 6:130643394-130643416 ATTGCTATGAATATTCTTGAAGG + Intergenic
1017202157 6:151766846-151766868 ATTGCAATGCAGATTACAGAAGG - Intronic
1017587379 6:155941964-155941986 ATAGCTTTGCAGAATGATGACGG - Intergenic
1018297983 6:162369806-162369828 AGTGCTATGCAAAATGTAGACGG - Intronic
1018491895 6:164302584-164302606 ATTGCTCTACAGATTTTAGAGGG + Intergenic
1019836469 7:3390104-3390126 ATTTCCAAGCAAATTGTTGAAGG + Intronic
1020413770 7:7922619-7922641 ATTGCTATGCAGATTGTTGATGG + Intronic
1024414154 7:49082637-49082659 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
1027995252 7:85417863-85417885 ATGGCTTTGGAGATTGTTAAAGG - Intergenic
1028473220 7:91226828-91226850 ATTTCTAGGCAGAATGTTGAAGG - Intergenic
1028490221 7:91403083-91403105 AGTTCTATGAAGAATGTTGATGG + Intergenic
1030043628 7:105474894-105474916 ATTGCTTTGCATATTGTCCATGG + Intronic
1030232532 7:107223311-107223333 ATTTCTATGGAGATTCTTTAGGG + Intronic
1030610770 7:111686663-111686685 ATTTCTATGCAGAATATTGAAGG + Intergenic
1031330639 7:120459326-120459348 CATGCTATGCAGATAATTGAGGG - Intronic
1032893090 7:136220775-136220797 ATTTCTGGGCAGAGTGTTGAAGG + Intergenic
1034476410 7:151286483-151286505 ATTGGTATGTAGATTTTTGGGGG - Intergenic
1036085010 8:5604067-5604089 ATTGGTATGCAGCTTGCAGAGGG - Intergenic
1040697893 8:50024086-50024108 ATGGCAATGCAGTTGGTTGAGGG + Intronic
1043754942 8:83991464-83991486 ATTTCTATGAAGAATGTTGTTGG - Intergenic
1044363868 8:91320372-91320394 ATTGCTATGCTTTGTGTTGATGG + Intronic
1045155686 8:99467688-99467710 ATTGTTATCCATTTTGTTGAAGG + Intronic
1045220046 8:100189827-100189849 ATTGCTACACAGATTTCTGAAGG - Intronic
1046030868 8:108782666-108782688 ATTTCTTTGCAGATTTTTAAAGG - Intronic
1046357770 8:113110359-113110381 ATTTCTAAGCAAAGTGTTGAAGG - Intronic
1047105684 8:121728008-121728030 ATTTCTAAGCAAAGTGTTGAGGG - Intergenic
1047540285 8:125758652-125758674 ATTGATAGGAAGATTGTTGTTGG - Intergenic
1049205805 8:141363053-141363075 ATTGCTATCAAGAGTGGTGATGG - Intronic
1051080158 9:13284744-13284766 ATTGCTATAAAGATTTTTAAAGG + Intergenic
1051659855 9:19415911-19415933 TTTGCAGTGCATATTGTTGAAGG + Intronic
1052421501 9:28248485-28248507 AAGGATATGCAGATTGTTGACGG + Intronic
1052738751 9:32373171-32373193 ATTGCTTTGCAGATGGAGGAAGG + Intergenic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1055277752 9:74639127-74639149 ATAGCTCTGCTGATTGTAGATGG + Intronic
1055497606 9:76871279-76871301 AATGCTATGTAAATTGTTGAAGG - Intronic
1056335374 9:85563478-85563500 ATTTCTAAGCAAACTGTTGAAGG + Intronic
1188056344 X:25545137-25545159 TTTGCTATGCAGAATTTTGCTGG - Intergenic
1188187511 X:27132508-27132530 ATTTCTATTAAGATTCTTGAAGG - Intergenic
1188519269 X:31019855-31019877 ATTTCTAAGCAAAGTGTTGAAGG + Intergenic
1190481506 X:50881690-50881712 ATTTCTAAGCAAAGTGTTGAAGG - Intergenic
1190804508 X:53822094-53822116 AATTCTAAGCAGAGTGTTGAAGG - Intergenic
1192338026 X:70238236-70238258 ATGGCTCAGCAGATAGTTGATGG - Exonic
1195281511 X:103338950-103338972 CTGGCTAGGCAGATTGGTGAAGG + Intergenic
1196185887 X:112744399-112744421 ATGGCTATGCAGATGGAAGAAGG - Intergenic
1197058326 X:122147404-122147426 ATTTCTAAGCAGAATGTTGTGGG + Intergenic
1197609030 X:128617585-128617607 ATTTCTATGAAGAATGTTGAAGG - Intergenic
1198079065 X:133221459-133221481 ATTTCTAAGCAAAGTGTTGAGGG - Intergenic