ID: 1020418877

View in Genome Browser
Species Human (GRCh38)
Location 7:7976811-7976833
Sequence CTCCTGAGTGATCCTCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020418874_1020418877 -7 Left 1020418874 7:7976795-7976817 CCAGCTACTCAGGATCCTCCTGA 0: 1
1: 3
2: 3
3: 42
4: 413
Right 1020418877 7:7976811-7976833 CTCCTGAGTGATCCTCAAGGAGG No data
1020418871_1020418877 21 Left 1020418871 7:7976767-7976789 CCTGGGCATGGTGGGACACTCCT 0: 1
1: 3
2: 102
3: 860
4: 2667
Right 1020418877 7:7976811-7976833 CTCCTGAGTGATCCTCAAGGAGG No data
1020418873_1020418877 1 Left 1020418873 7:7976787-7976809 CCTGTAGTCCAGCTACTCAGGAT 0: 3
1: 179
2: 747
3: 1350
4: 1933
Right 1020418877 7:7976811-7976833 CTCCTGAGTGATCCTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020418877 Original CRISPR CTCCTGAGTGATCCTCAAGG AGG Intronic
No off target data available for this crispr