ID: 1020419322

View in Genome Browser
Species Human (GRCh38)
Location 7:7983198-7983220
Sequence TCTTACATGGTTATAGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020419322_1020419328 20 Left 1020419322 7:7983198-7983220 CCTCTGACTATAACCATGTAAGA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1020419328 7:7983241-7983263 AGGAATTTTAGGAAATAGGGAGG 0: 1
1: 0
2: 4
3: 24
4: 269
1020419322_1020419329 26 Left 1020419322 7:7983198-7983220 CCTCTGACTATAACCATGTAAGA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1020419329 7:7983247-7983269 TTTAGGAAATAGGGAGGTATAGG 0: 1
1: 0
2: 0
3: 24
4: 294
1020419322_1020419324 0 Left 1020419322 7:7983198-7983220 CCTCTGACTATAACCATGTAAGA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1020419324 7:7983221-7983243 AACTGTATAAAATTGTATGTAGG No data
1020419322_1020419325 9 Left 1020419322 7:7983198-7983220 CCTCTGACTATAACCATGTAAGA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1020419325 7:7983230-7983252 AAATTGTATGTAGGAATTTTAGG 0: 1
1: 0
2: 4
3: 38
4: 420
1020419322_1020419327 17 Left 1020419322 7:7983198-7983220 CCTCTGACTATAACCATGTAAGA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1020419327 7:7983238-7983260 TGTAGGAATTTTAGGAAATAGGG 0: 1
1: 0
2: 6
3: 35
4: 378
1020419322_1020419326 16 Left 1020419322 7:7983198-7983220 CCTCTGACTATAACCATGTAAGA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1020419326 7:7983237-7983259 ATGTAGGAATTTTAGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020419322 Original CRISPR TCTTACATGGTTATAGTCAG AGG (reversed) Intronic
903424535 1:23244111-23244133 TCTTACATGGTTAGTCGCAGTGG + Intergenic
903641169 1:24861531-24861553 TCTCACATGGCTATTGTTAGGGG + Intergenic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
904856951 1:33505745-33505767 TGTTACATGGATATAGTGTGTGG + Intergenic
907854371 1:58287423-58287445 TCTCATGTGGTTATAGTCAGTGG + Intronic
909744640 1:79078672-79078694 TCTTACATGGCTAGAGAAAGAGG - Intergenic
914384156 1:147151380-147151402 TCTTACATGGTAGAAGGCAGAGG + Intergenic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
918399239 1:184147047-184147069 TCTTTCCTGGTTGTGGTCAGAGG - Intergenic
919305033 1:195821396-195821418 TGTTACATGGCTATACTGAGTGG - Intergenic
923481317 1:234386970-234386992 TCTTACATGGGTACAGTTTGTGG + Intergenic
1063290239 10:4737910-4737932 TCTGACTTGGTTATAGACACAGG - Intergenic
1065837313 10:29670259-29670281 TCTTAGGTGTATATAGTCAGTGG - Intronic
1066422243 10:35274174-35274196 TCTTACATGGTGGCAGTCAAGGG + Intronic
1068869222 10:61925840-61925862 TCCTTCATGGTTATAGCCAACGG - Intronic
1069765215 10:70851673-70851695 GCTTACATGGTTTAGGTCAGGGG + Intronic
1071324375 10:84497538-84497560 TCTTAGGTGGTTATAGTGTGTGG + Intronic
1071400847 10:85269056-85269078 TCTTACATGGGTACAGTTTGTGG + Intergenic
1071538567 10:86457013-86457035 TCTTACAAGGTAGTTGTCAGAGG + Intronic
1077772954 11:5240788-5240810 TCTAACTTGGGTATAGTCAGAGG - Intergenic
1078070678 11:8107445-8107467 TCTTAAATGGCTATAGACAGGGG + Intronic
1078325122 11:10374439-10374461 TATTACATGGTTAATGTCATAGG + Intronic
1078918661 11:15805990-15806012 TCTTATAGGGTTCTACTCAGAGG - Intergenic
1080050173 11:27851581-27851603 TCTCACAAGGCTACAGTCAGTGG - Intergenic
1082630983 11:55541684-55541706 TCTTACATGGATATATTATGAGG - Intergenic
1083023993 11:59534466-59534488 TCTTACATGGTTCCAGCCACAGG - Intergenic
1087262447 11:96025899-96025921 TCTATAATGGTTATAATCAGAGG - Intronic
1088182498 11:107128225-107128247 TCTTCCATGGTTCAAGTCACAGG - Intergenic
1090687051 11:129133100-129133122 TCTTACATGTTTAGAGCCGGTGG + Intronic
1097110425 12:56653972-56653994 TCTTATATGGTTATAGATAAGGG + Intergenic
1097792767 12:63832371-63832393 TCCTTCATGGTTAAAGTTAGAGG - Intergenic
1097965685 12:65578096-65578118 TCTTATATCTTTATAGTCTGAGG - Intergenic
1098096038 12:66957072-66957094 TCAAATATGGTTATAGTCTGAGG - Intergenic
1099311530 12:81031838-81031860 TCTTACAAGGCTATAATTAGGGG - Intronic
1099726585 12:86437816-86437838 TCTTACATGGTTGTGGTGTGTGG - Intronic
1100673292 12:96839453-96839475 TCTTTCATGAGTATACTCAGAGG - Intronic
1100712445 12:97272684-97272706 TCCTACATGGTTTTGGTAAGAGG - Intergenic
1101742518 12:107511740-107511762 TCTTGCATGCATATAGACAGGGG + Intronic
1102936053 12:116897976-116897998 TCTGACATGGTTATTGTCACAGG - Intergenic
1106389338 13:29320006-29320028 TCATACATGGACATATTCAGGGG - Intronic
1107511884 13:41093490-41093512 TCTTACATGGTTAGAGCAGGAGG - Intergenic
1107806385 13:44157608-44157630 TTTTACATGGTCATGGTGAGGGG - Intronic
1108233137 13:48371241-48371263 GTTCACATGGTAATAGTCAGTGG + Intronic
1109875307 13:68395157-68395179 TCTTAGATGGTGACTGTCAGTGG - Intergenic
1110998892 13:82151698-82151720 TTTTATATGGTTATAGATAGGGG - Intergenic
1111724550 13:91989326-91989348 TCTTACATGTTTAGAGTAATGGG - Intronic
1114375099 14:22137135-22137157 TGTTACATTGTTATATTGAGAGG - Intergenic
1115065596 14:29256508-29256530 TTTTACAGGCTTATAGGCAGAGG - Intergenic
1116364166 14:44039524-44039546 TTTTACAGGGTCATAGGCAGAGG + Intergenic
1116495475 14:45554790-45554812 TCTTACATGGTAAGAGCAAGAGG + Intergenic
1117241578 14:53838999-53839021 TCTTACATGGTTGGAGTAGGAGG + Intergenic
1119816816 14:77576711-77576733 TTTGACATTGTTTTAGTCAGGGG - Intronic
1120310259 14:82818033-82818055 TCTTAAATGTTTATGGTAAGAGG + Intergenic
1120465207 14:84847997-84848019 TCTTACATTGTGATTCTCAGTGG + Intergenic
1120818908 14:88893811-88893833 TCTTACATGGTGGTAGCAAGAGG + Intergenic
1121200212 14:92110663-92110685 TTTTTCATGGTTATAGTCCCAGG - Intergenic
1125231641 15:37463387-37463409 TCTTACATGGTGGTAGGCAAGGG + Intergenic
1125624314 15:41094131-41094153 TCTTACAAGATTACTGTCAGTGG - Intronic
1126843167 15:52736557-52736579 TCTTACATGGTGGCAGGCAGGGG - Intergenic
1129438632 15:75562428-75562450 ACATACATGGTTAAAGGCAGAGG + Intronic
1130439248 15:83934443-83934465 TTTTACAGGCTTATAGGCAGAGG + Intronic
1131301127 15:91200511-91200533 TCTTACATGGTTGTGGTCAGTGG + Intronic
1132593864 16:739351-739373 TCTTACATGGTTAGAACTAGGGG + Intronic
1135588325 16:23688245-23688267 TCTATCATGGTAAGAGTCAGAGG - Intronic
1137026722 16:35483956-35483978 TTTTACATGGTGAGAGTCACGGG - Intergenic
1137920686 16:52485595-52485617 TGTTACATGGGTATATTCATGGG - Intronic
1139067513 16:63336607-63336629 TCTTACATGGTTGGAGTAGGAGG + Intergenic
1139350228 16:66330342-66330364 TCATACAAGGTCATATTCAGAGG + Intergenic
1140674712 16:77316561-77316583 TGTGAGATGGGTATAGTCAGGGG - Intronic
1143099679 17:4498467-4498489 TCTCAGATGGCTAAAGTCAGGGG - Intergenic
1143184949 17:5004449-5004471 TCTTACAGGGTCATGGTCTGAGG - Intronic
1143587745 17:7859137-7859159 TGTTGCATGGATATAGTGAGGGG + Intronic
1144033112 17:11340127-11340149 GCTTACATGGTTATATTTATAGG - Intronic
1144358406 17:14468151-14468173 TCTTACATGGTTAGAGCAGGAGG + Intergenic
1146657509 17:34643634-34643656 CCTTACTTGGTTATTGTGAGGGG - Intergenic
1149310831 17:55391440-55391462 TCTTATAGGATAATAGTCAGTGG + Intergenic
1149394315 17:56223727-56223749 CCTTAAATGGTTATAATCGGGGG - Intronic
1151002956 17:70399778-70399800 TTTTACAGGCTTATAGGCAGGGG + Intergenic
1153208530 18:2732149-2732171 TCATACATTGTTATACTCACAGG - Intronic
1154503684 18:15010574-15010596 TCATACATGGTGAAAGTTAGAGG - Intergenic
1156119816 18:33829148-33829170 TCTTACATGGTTTGTGGCAGAGG + Intergenic
1158118498 18:54023430-54023452 TCCTCCAGGGTTGTAGTCAGAGG + Intergenic
1158506294 18:58048771-58048793 TCTAACCTAGTTACAGTCAGTGG + Intronic
926569084 2:14509753-14509775 TCTTCCTTGGTAATACTCAGTGG + Intergenic
926833338 2:16989062-16989084 TCTTTCATGGGTTTATTCAGGGG + Intergenic
928204452 2:29273998-29274020 TCTTTCATGGTTCTAGTTAAAGG + Intronic
930511887 2:52356408-52356430 TGTAAAATGGTTATAGTCAGGGG + Intergenic
932723122 2:74153725-74153747 TCATACATGATTACAGTCATGGG - Exonic
932944794 2:76215546-76215568 TCTTAAATGGTTAAAGCCAGTGG - Intergenic
935324742 2:101925834-101925856 TCTTACATGGTCAGAGCAAGAGG - Intergenic
938025762 2:127946568-127946590 TCTAATATAGTTATAGTCACAGG - Intronic
938409857 2:131054983-131055005 TCTTACATGGTCATAGGGGGTGG + Intronic
938502860 2:131840728-131840750 TCATACATGGTGAAAGTTAGAGG - Intergenic
940134322 2:150418986-150419008 TGTTACATGTATTTAGTCAGTGG + Intergenic
940402792 2:153266930-153266952 TTTTACAGGCTTATAGGCAGAGG - Intergenic
941925506 2:170890190-170890212 TCTCAGATATTTATAGTCAGTGG + Intergenic
942467912 2:176228641-176228663 TCTTACTTGGTAATACTCACAGG - Intergenic
942855014 2:180535032-180535054 TCCTACATGTGTATAGTCAAAGG - Intergenic
942936677 2:181565242-181565264 TGTTACATGGTGATGGGCAGGGG - Intronic
943764619 2:191647394-191647416 TCATACAAGATTATAGTCTGAGG + Intergenic
945578799 2:211566222-211566244 CCTTACATGGTATCAGTCAGCGG + Intronic
946870467 2:224079735-224079757 TCTTACATGGTCAGAGTAGGCGG - Intergenic
1171339412 20:24415612-24415634 TCTTACATGGTTGTAGATAAGGG + Intergenic
1181988873 22:26821566-26821588 CATTAAATGGTTATTGTCAGTGG - Intergenic
951985124 3:28611154-28611176 TCTCAAATGGTTATATTCAGGGG + Intergenic
952541369 3:34371246-34371268 TTTTACAGGCTTATAGGCAGAGG + Intergenic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956212680 3:66817964-66817986 TTTTACATTGTTGTAGTCAACGG + Intergenic
956638212 3:71387890-71387912 ACTGACTTGGTTATAGTCAGAGG + Intronic
957822323 3:85393689-85393711 TCTTACAAGGTTAGTATCAGAGG - Intronic
959757670 3:109918120-109918142 GCTTATATTGTTATAGTCTGAGG - Intergenic
960936237 3:122904787-122904809 TGTACCATGGTTATAATCAGGGG + Intergenic
961441598 3:126956924-126956946 AGTCACATGGTTATAGTCACGGG + Intronic
964079147 3:152730245-152730267 TCTTACATGGTTAGTTTCATGGG + Intergenic
966458400 3:180144795-180144817 TCTTAAATGGTGGTTGTCAGGGG + Intergenic
968397225 4:252144-252166 TCTTGCATTGTTATTTTCAGTGG + Intergenic
974765635 4:66341961-66341983 TCTTCCATGATGATAGTTAGGGG - Intergenic
975896137 4:79093261-79093283 TCTTTTATGGTTATAGTGACAGG - Intergenic
976328553 4:83800792-83800814 TGTTACATGGATATAGTTTGTGG + Intergenic
980450457 4:132962884-132962906 ATTTACATGGTTATATTCATAGG + Intergenic
980732278 4:136838344-136838366 TCTTACATGGTGGGAGCCAGAGG - Intergenic
982428709 4:155297718-155297740 TCTTACATGGTGAGAGTAGGAGG + Intergenic
988253126 5:28786351-28786373 TCTTACATGGTAACAGGCAAGGG - Intergenic
992060729 5:73044083-73044105 TCTTACATGGCCAGAGTAAGAGG - Intronic
992157264 5:73967624-73967646 TCTTACATGGCTAGAGTAGGAGG - Intergenic
996697850 5:126418667-126418689 TGTTTCATGGTTATATTCATTGG + Intronic
998357726 5:141555134-141555156 ATTTACATGGTTGTAATCAGAGG - Intronic
1000465296 5:161568387-161568409 TCTTACATGGTTATCTACAGAGG + Intronic
1000539938 5:162527111-162527133 TCTTACAAGGTCATTGTCATTGG - Intergenic
1000773486 5:165386940-165386962 TCTTACATATATATAGTCAATGG + Intergenic
1010450309 6:75994932-75994954 TCTTACCTCTTTTTAGTCAGTGG - Intronic
1013549055 6:111189672-111189694 TCTTACATGGTGGCAGGCAGGGG + Intronic
1016068255 6:139706171-139706193 TCTCACAAGGTTGGAGTCAGAGG - Intergenic
1020419322 7:7983198-7983220 TCTTACATGGTTATAGTCAGAGG - Intronic
1021799477 7:24289865-24289887 TCTAACATTGTTGGAGTCAGGGG + Intronic
1022902861 7:34827586-34827608 TCTTACCTGATGATTGTCAGAGG - Exonic
1023514389 7:40986478-40986500 TCATTAAGGGTTATAGTCAGTGG - Intergenic
1024184552 7:46936883-46936905 TCTTACATGGTGGCAGGCAGGGG - Intergenic
1025792275 7:64700359-64700381 TATCACATGGTAATAGACAGAGG - Intronic
1027671608 7:81106319-81106341 TCTTACATAGATATAGGAAGGGG - Intergenic
1028134752 7:87213681-87213703 TCTTACATGATTATTTGCAGAGG + Intronic
1029463067 7:100707317-100707339 TCTTACATGGCTCTGGTCCGAGG - Exonic
1032202318 7:129830790-129830812 TATTAAGAGGTTATAGTCAGAGG + Exonic
1032937107 7:136745635-136745657 TCTTATATGGTTATAGATAAGGG - Intergenic
1038306515 8:26408110-26408132 TCTCACATGTTTCTTGTCAGTGG + Intronic
1039635245 8:39157805-39157827 TCTTGTCAGGTTATAGTCAGTGG + Intronic
1041531110 8:58868155-58868177 TCTTACATGGTGGCAGTCAAGGG - Intronic
1044135991 8:88586148-88586170 TATTTTATGGTTATAATCAGTGG + Intergenic
1044889521 8:96818299-96818321 TCTTACATGGGTGTAGTTCGTGG + Intronic
1046441770 8:114265044-114265066 TCATCCATCGCTATAGTCAGAGG - Intergenic
1046547994 8:115675634-115675656 TCTTCCATGGCTATACTCATAGG + Intronic
1048079464 8:131109705-131109727 TCTTACATGGATGCAGTTAGCGG + Intergenic
1049963701 9:759953-759975 TCCTAGATTGTCATAGTCAGAGG - Intergenic
1050187578 9:2991302-2991324 TGCTACATGGTTGTAGTAAGAGG - Intergenic
1050483111 9:6106335-6106357 TGTTACATGGATATATTGAGTGG - Intergenic
1052031407 9:23633522-23633544 TGTTACATTGTTAAATTCAGTGG - Intergenic
1052233377 9:26182205-26182227 CCTTCCATTTTTATAGTCAGTGG - Intergenic
1052647092 9:31250703-31250725 TCTTATATGGTAAGAGACAGGGG - Intergenic
1053554485 9:39121498-39121520 TCTTACACAGTTAAAGTCATAGG + Intronic
1053818581 9:41941640-41941662 TCTTACACAGTTAAAGTCATAGG + Intronic
1054108846 9:61085298-61085320 TCTTACACAGTTAAAGTCATAGG + Intergenic
1054612011 9:67245827-67245849 TCTTACACAGTTAAAGTCATAGG - Intergenic
1055334103 9:75214690-75214712 TCTTAAATGGCAATAGTCACTGG - Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1056777376 9:89523432-89523454 TCTTCCATGAGTATAATCAGGGG - Intergenic
1056936629 9:90919666-90919688 TCTTGCATGGGTATTGTCAGTGG + Intergenic
1056983104 9:91335046-91335068 TCTTACGTGGTGGTTGTCAGGGG + Intronic
1059651270 9:116318531-116318553 TCTTACAGGGTGAGAGGCAGTGG - Intronic
1187298000 X:18021311-18021333 TCTGACATGTTTATACCCAGGGG - Intergenic
1188415353 X:29926428-29926450 TTATACATGGTTATAGTCACTGG + Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1191862713 X:65679006-65679028 GCTTACATGTTGATAGCCAGAGG - Intronic
1193965023 X:87974783-87974805 TCTTACATGGCTAGAGCAAGAGG - Intergenic
1194754920 X:97727563-97727585 TCTTACCTGGCTGTGGTCAGAGG + Intergenic
1195924120 X:110008600-110008622 TCTTTCATTGTTACAGTCATTGG + Intronic
1196576997 X:117330387-117330409 TCTTACATGGGTATATTCCTTGG - Intergenic
1196754475 X:119145931-119145953 AATTCCATAGTTATAGTCAGTGG - Intronic
1197451790 X:126628695-126628717 TTTTACAGGCTTATAGGCAGTGG - Intergenic
1198091511 X:133335614-133335636 TCTGACATTTTTATAGTCATTGG - Intronic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic