ID: 1020419323

View in Genome Browser
Species Human (GRCh38)
Location 7:7983211-7983233
Sequence ATTTTATACAGTTTCTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 450}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020419323_1020419328 7 Left 1020419323 7:7983211-7983233 CCATGTAAGAAACTGTATAAAAT 0: 1
1: 0
2: 4
3: 34
4: 450
Right 1020419328 7:7983241-7983263 AGGAATTTTAGGAAATAGGGAGG 0: 1
1: 0
2: 4
3: 24
4: 269
1020419323_1020419329 13 Left 1020419323 7:7983211-7983233 CCATGTAAGAAACTGTATAAAAT 0: 1
1: 0
2: 4
3: 34
4: 450
Right 1020419329 7:7983247-7983269 TTTAGGAAATAGGGAGGTATAGG 0: 1
1: 0
2: 0
3: 24
4: 294
1020419323_1020419327 4 Left 1020419323 7:7983211-7983233 CCATGTAAGAAACTGTATAAAAT 0: 1
1: 0
2: 4
3: 34
4: 450
Right 1020419327 7:7983238-7983260 TGTAGGAATTTTAGGAAATAGGG 0: 1
1: 0
2: 6
3: 35
4: 378
1020419323_1020419325 -4 Left 1020419323 7:7983211-7983233 CCATGTAAGAAACTGTATAAAAT 0: 1
1: 0
2: 4
3: 34
4: 450
Right 1020419325 7:7983230-7983252 AAATTGTATGTAGGAATTTTAGG 0: 1
1: 0
2: 4
3: 38
4: 420
1020419323_1020419326 3 Left 1020419323 7:7983211-7983233 CCATGTAAGAAACTGTATAAAAT 0: 1
1: 0
2: 4
3: 34
4: 450
Right 1020419326 7:7983237-7983259 ATGTAGGAATTTTAGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020419323 Original CRISPR ATTTTATACAGTTTCTTACA TGG (reversed) Intronic
900078811 1:839687-839709 ATTTTATTCTGTTCCTTTCAAGG - Intergenic
900738087 1:4312072-4312094 CTTTTTGACAGTTTCTTATATGG - Intergenic
901357842 1:8667271-8667293 ATTATATATCGTTTCTTACTTGG - Intronic
904332751 1:29773350-29773372 ATTTGATAGAGTTATTTACATGG + Intergenic
906585662 1:46975654-46975676 ATCTTATATAGTATCTTGCAGGG + Intergenic
907365952 1:53960087-53960109 ATTTTTTAAAATTTCTTGCAGGG + Intronic
908685884 1:66719283-66719305 ATTTCATGCAGGTTCTTCCAGGG + Exonic
908876056 1:68677176-68677198 GTTTTATTCAGATTTTTACAGGG + Intergenic
909070485 1:70987372-70987394 TTTATCTACAGTTTTTTACAAGG + Intronic
909096748 1:71297034-71297056 AGTTTATAGACTTTCTTACAGGG - Intergenic
909633685 1:77792519-77792541 AGTTTCTACAGTTTGTTTCAAGG + Intronic
909737883 1:78988168-78988190 AATTTAAACAGTTTATTTCAGGG + Intronic
909874129 1:80780906-80780928 ATCTTGTACAGTATCTTGCAGGG - Intergenic
910017439 1:82544737-82544759 ATGTTATACAGTTTTTTTCTAGG - Intergenic
910064730 1:83139846-83139868 ATCTTATATAGTATCTTGCAGGG + Intergenic
910166696 1:84336035-84336057 ATTTTGTATAGTATCTCACAAGG + Intronic
910855379 1:91689823-91689845 TTTTTAATCAGTTTCTTAAAGGG - Intronic
911375062 1:97042438-97042460 ATCTTATACAGTATCTTGCAGGG + Intergenic
911612379 1:99970828-99970850 ATTTGGTGCAGTTTCTTACTTGG + Intronic
911899240 1:103480574-103480596 ATATTATACAGATCCTTACCAGG + Intergenic
912125237 1:106529007-106529029 ATTTTCTACATTATCTTCCAGGG - Intergenic
912202392 1:107472822-107472844 AATCTATAAAGTTTCTTCCATGG + Intronic
912535548 1:110366769-110366791 ATTTAATATATTTTCTTACCAGG + Intronic
916562545 1:165945653-165945675 TCTTTTTACAGTTTCTTAAAAGG + Intergenic
916673621 1:167046918-167046940 ATATTCTACAGTTTCTCAGAGGG + Intergenic
917011461 1:170478796-170478818 ATTTCCTACATTTTCTTCCAGGG + Intergenic
918515781 1:185360977-185360999 ATCTTGTATAGTATCTTACAGGG - Intergenic
919016380 1:192043044-192043066 ATTTTATACATTTTCCTGTAAGG - Intergenic
919556412 1:199059986-199060008 ATTTTCTACTGTTTTCTACATGG + Intergenic
919663092 1:200267207-200267229 ATTTTATTTATTTTTTTACAAGG + Intergenic
920634568 1:207687215-207687237 ATTTTATATAAACTCTTACAAGG - Intronic
921462078 1:215441064-215441086 ATTTTAAATTGTTTCTTAAAAGG + Intergenic
921543900 1:216451585-216451607 ATTTTAAATAGTTTATTTCATGG - Intergenic
921751793 1:218802887-218802909 ATCTTGTATAGTTTCTTGCAGGG + Intergenic
924079937 1:240384815-240384837 ATTATAAACCCTTTCTTACAGGG + Intronic
924840083 1:247699471-247699493 ATTTTATACAATATCTTATGAGG + Intergenic
1062990421 10:1809473-1809495 ATCTTATACGTTTTCTTAAAAGG - Intergenic
1063155693 10:3377182-3377204 ATTTGAAAAAGTGTCTTACAGGG - Intergenic
1063541641 10:6939966-6939988 ATTTTAAAAAGTTTATTTCAAGG + Intergenic
1064433802 10:15293343-15293365 ATTATTTACAGTTAGTTACATGG - Intronic
1065164650 10:22962983-22963005 ATTTTATCCTGTTTTTTAAAAGG + Intronic
1065425009 10:25592079-25592101 ATTTTATATTGTTTCATTCAAGG - Intronic
1065581547 10:27176726-27176748 ATTTTAAACAGTTTCTAATAAGG - Intronic
1066023303 10:31323671-31323693 AATTTATATAGTTTCTTGAAAGG - Intronic
1066036781 10:31497853-31497875 ATTTTAGAAAGTTTCAAACATGG + Intronic
1066318109 10:34269594-34269616 CTTTTATACAGCTTCTGACAGGG - Intronic
1067139531 10:43645249-43645271 ATTTTATACATTTTCTTAAAAGG - Intronic
1068830546 10:61489962-61489984 AGTGTACACAGTTTCTCACATGG + Intergenic
1069168676 10:65197143-65197165 CCTTTTTACAGTGTCTTACATGG - Intergenic
1069352298 10:67543410-67543432 ATTTTATAAAGCTTCCTATATGG + Intronic
1070389663 10:75958379-75958401 ATTTTATAATGTTTCTAACAAGG - Intronic
1071022950 10:81080955-81080977 ATCTTGTACAGTATCTTGCAGGG + Intergenic
1072057550 10:91774991-91775013 TTTTTATACTTTTTCTTAAAGGG + Intergenic
1074759229 10:116653703-116653725 ATCTTATATAGTATCTCACAGGG + Intergenic
1077128916 11:959615-959637 AGTTTGTACAGTTTCTATCAGGG + Intronic
1077524265 11:3054836-3054858 TTTTTATACAGTTTAATTCAAGG - Intronic
1079982430 11:27165355-27165377 ATTTTCTAAAGTATCTTCCATGG + Intergenic
1081376385 11:42363525-42363547 TTTTTGTGCAGTTTCTTTCATGG - Intergenic
1082959997 11:58909875-58909897 GTTTTATACAATTTCTTCAACGG + Intronic
1083978777 11:66147042-66147064 TTTTTAGACAGTGTCTTACTTGG - Intronic
1084925679 11:72509438-72509460 ATCTTATACAGTACCTCACAGGG + Intergenic
1085073537 11:73571098-73571120 ATTTTATTCATTTTTTTCCAGGG - Intronic
1085731543 11:79003303-79003325 ATCTTGTACAGTATCTCACAAGG - Intronic
1086610970 11:88755115-88755137 ATTTGCTTCAGTTTCTTATAAGG - Intronic
1087241226 11:95783264-95783286 ATTTAACACATTTTCTTAAAAGG - Exonic
1087289841 11:96308195-96308217 ATTTTATATTCTTTATTACATGG - Intronic
1087332957 11:96805925-96805947 ATTTTATACATTTTCTTTGATGG + Intergenic
1087955801 11:104286642-104286664 ATTTTATATTGTTTCTTGCATGG - Intergenic
1089753005 11:120664967-120664989 ATTTTATACTCTGTCTTACGAGG + Intronic
1089933031 11:122333608-122333630 ATTCATTACAGGTTCTTACAGGG + Intergenic
1090352399 11:126115739-126115761 ATTTTATCCACTTTCTCTCAGGG + Intergenic
1090433564 11:126667037-126667059 ATTTTGTACAATTTATTTCAGGG + Intronic
1092863426 12:12739687-12739709 ATTTTATACCTTTAATTACATGG + Intronic
1093092041 12:14932680-14932702 TTTATATACAGTTTCTAAAATGG - Intronic
1093273360 12:17093929-17093951 ATTCCATACAGCTTCTTAGAAGG + Intergenic
1093393746 12:18654984-18655006 TTTTTATTCAGCTTCTTATATGG - Intergenic
1093695794 12:22158921-22158943 ATTGTTTGCAGTTTTTTACAGGG + Intronic
1094626990 12:32133752-32133774 ACTTTATCCAGTTTCTGAAATGG + Intronic
1095757008 12:45780005-45780027 ATTAAAAACAGTTTCTTACAAGG + Intronic
1095794558 12:46203773-46203795 ATTCTATTCTGTATCTTACAAGG - Intronic
1095880428 12:47130036-47130058 ATATTATTCAGTTTCATATATGG + Intronic
1096455885 12:51785951-51785973 ATTTTATACTGTTTGGTAGAGGG + Intronic
1096659361 12:53114423-53114445 ATTTTAAACAGTTTCTGGCTGGG + Intronic
1096896920 12:54830381-54830403 ATTTTATCCTGTTTCTCTCATGG + Intergenic
1097414531 12:59298179-59298201 ATTATTTACAGTTTCTGAAATGG - Intergenic
1098508543 12:71283816-71283838 ATTCTATACATTTTCTTAGTAGG + Intronic
1098621318 12:72603181-72603203 ATTTTTTACTGCTTCTAACATGG - Intronic
1099044764 12:77703580-77703602 AATTTAGGCAGTTTCTTAGAAGG - Intergenic
1100126619 12:91435068-91435090 ATTTTATGCTGTTTTTTTCAAGG + Intergenic
1100266378 12:92980224-92980246 ATCTTGTATAGTATCTTACAGGG - Intergenic
1100864139 12:98837908-98837930 ATTTTATAAAGTGTCTAAAATGG - Intronic
1101096540 12:101347605-101347627 AATTTATACTGTTGATTACATGG + Intronic
1104277521 12:127343266-127343288 ATTTTATACAGTCTGTTTCCTGG - Intergenic
1105031256 12:132885635-132885657 ATGTTATACATGTTATTACATGG - Intronic
1105408032 13:20147545-20147567 ATTTTATACACTCTCTTACGTGG + Intronic
1105533523 13:21242671-21242693 TTTTGAAACAGTTTGTTACATGG + Intergenic
1105727105 13:23174447-23174469 ATTATAAACAGTTTCTGTCATGG - Intergenic
1108526499 13:51290134-51290156 TTTTTCTACAGTATCTTACATGG - Intergenic
1108936450 13:55887377-55887399 ATTTTATACAATTATTTACAAGG - Intergenic
1109531722 13:63658367-63658389 ATTTTATATCATTTCTTTCATGG + Intergenic
1110168516 13:72472585-72472607 GTTTTTTAAAGTTTCTTATATGG + Intergenic
1111410542 13:87871524-87871546 ATTCTATACAGCTTTTTAAAGGG + Intergenic
1111734788 13:92124380-92124402 TTTTTAAACAGTTTCTACCATGG - Intronic
1112067177 13:95805584-95805606 ATTTTATCCAGTCTTTTAAAAGG + Intronic
1112147808 13:96720976-96720998 TTTTTCTTCAGTTTCTTGCAGGG - Intronic
1112690174 13:101884325-101884347 AGATTAAACATTTTCTTACACGG - Intronic
1112738973 13:102452953-102452975 GTTTTATACAATTTCTTTAAAGG + Intergenic
1112843453 13:103608372-103608394 GATTCATACAGTTTCTTAAAGGG + Intergenic
1112999031 13:105610654-105610676 ATTATATGCAGTTTCTGACTCGG - Intergenic
1113606076 13:111607370-111607392 ATATTAAACACTTTTTTACAGGG - Intronic
1115415647 14:33130128-33130150 ATTTAATGCAGTTTCTTAAATGG + Intronic
1115957817 14:38800949-38800971 ATTGTATACAGTGTTTCACAGGG - Intergenic
1116795089 14:49381675-49381697 ATTTTATTCTGATTCTTAAAGGG - Intergenic
1117076766 14:52113163-52113185 TTTTTATACAGCTTCTTGAAGGG + Intergenic
1117378156 14:55134618-55134640 AACTTATACGGTTTCTTATACGG + Intronic
1117450369 14:55844312-55844334 ATTCTTTAAAGTTTCTTTCAAGG + Intergenic
1118536355 14:66770505-66770527 ATTTTCTACAGTAACTTTCATGG - Intronic
1118821937 14:69351374-69351396 ATTGGACCCAGTTTCTTACATGG - Intronic
1119839671 14:77782683-77782705 ATTTTTTAAAGTTTCATATATGG + Intergenic
1119952209 14:78756803-78756825 ATTTTAATCAGTCTATTACACGG - Intronic
1120845390 14:89120563-89120585 AATTTATTGAGTCTCTTACATGG - Intergenic
1121133385 14:91471197-91471219 ATGTGAAACAGTTTCTTATAGGG - Intronic
1121305262 14:92902629-92902651 ATTTTACACCGTTCCTCACAGGG - Intergenic
1121382432 14:93484791-93484813 ATTTTATTCAGTCTGTTAGAAGG + Intronic
1122834064 14:104422518-104422540 ATTTTATGGAGTTCCTCACACGG - Intergenic
1126320280 15:47414907-47414929 ATTTTAAATAGTCTCTTAAATGG + Intronic
1128450101 15:67800855-67800877 ATATTATTCAACTTCTTACATGG - Intronic
1131721567 15:95174304-95174326 ATTTTATATATTTTCTTAACAGG - Intergenic
1131970946 15:97892220-97892242 TTTTTATTCTCTTTCTTACATGG - Intergenic
1133601749 16:7346410-7346432 ATTTTGTACAGTTCCTTCCTGGG + Intronic
1135265097 16:21018428-21018450 ATTTTATATAATGTCTTACTTGG + Intronic
1135428178 16:22357790-22357812 ACTTTCTATAGTTTCTTAAATGG - Intronic
1137346187 16:47663058-47663080 ATTTTATCCAATTTGTTAAAAGG + Intronic
1137434208 16:48442286-48442308 AGTTTATTCAGATTCTCACATGG + Intronic
1138844322 16:60546867-60546889 ATTTGTCACTGTTTCTTACATGG + Intergenic
1143209547 17:5174792-5174814 GTTTTATACAGTAATTTACAAGG - Exonic
1144260889 17:13519470-13519492 ACTTTTAACAGTTTCTTATATGG - Intronic
1144468649 17:15517301-15517323 ATCTAACACAGTTTCTTTCAGGG + Intronic
1144619027 17:16804257-16804279 GTTTTATACAGTCATTTACAAGG - Intronic
1144893673 17:18511438-18511460 GTTTTATACAGTCATTTACAAGG + Intergenic
1145138549 17:20432836-20432858 GTTTTATACAGTCATTTACAAGG - Intergenic
1146581581 17:34043310-34043332 ATTTTTTAAAGGTTATTACATGG + Intronic
1147274796 17:39306821-39306843 GTTTTAAACAGTCCCTTACATGG - Intronic
1147465846 17:40610089-40610111 ATTTTAAACTGTTTTTTTCATGG - Intergenic
1148033650 17:44641082-44641104 TTTTTATTCAGTCTGTTACAGGG - Intergenic
1148188294 17:45660552-45660574 ATTTTATTCAGTGTGTTAAATGG + Intergenic
1149247603 17:54729291-54729313 ATCTTGTACAGTATCTCACAGGG - Intergenic
1149374018 17:56025603-56025625 ATGTTATACATTTACTTAAATGG - Intergenic
1149558126 17:57588743-57588765 ATTTCATAGATGTTCTTACAGGG + Intronic
1149701499 17:58658973-58658995 ATTTTATACCGTTTCTAGGAAGG - Intronic
1149870596 17:60177407-60177429 GTTTTATACAGTAATTTACAAGG + Intergenic
1150158470 17:62873801-62873823 ATATTATACAGTTTCAAATAGGG - Intergenic
1150200271 17:63348666-63348688 ATATTTTACATGTTCTTACATGG + Intronic
1150665742 17:67135580-67135602 ATATTATATAGTATTTTACATGG - Intronic
1150901708 17:69285679-69285701 ATTAGTTACAGTTTCTTGCATGG + Intronic
1153211342 18:2768416-2768438 AATTGATACAGCTTCTTATAAGG + Intronic
1153231837 18:2945124-2945146 ATTTTAATCAGTTTTTTTCATGG - Intronic
1155711444 18:28885640-28885662 ATTATATACAGCTGCTTGCATGG - Intergenic
1155840697 18:30638928-30638950 TATTTTTACAGTTTCTTCCAAGG - Intergenic
1155946467 18:31857956-31857978 TCTTTATACATTTTCCTACAGGG - Exonic
1156178808 18:34579144-34579166 ACTTTTTAAAGGTTCTTACATGG - Intronic
1156429971 18:37061749-37061771 TTTATATTCAGATTCTTACAGGG + Intronic
1156783989 18:40887202-40887224 TTTTTGTACAGCTTCTTAAATGG + Intergenic
1157051043 18:44165045-44165067 ATTTTATATATTTAATTACATGG - Intergenic
1158052464 18:53239777-53239799 ATGATATACAGTATTTTACATGG + Intronic
1158204642 18:54979269-54979291 ATATTAAACAATTTCTTAAAGGG + Intergenic
1158237346 18:55332144-55332166 ATTATAAACATTTTCTTAGAGGG + Intronic
1158353587 18:56591206-56591228 ATTTCATACAGTTTTTTACATGG - Intergenic
1158827282 18:61237274-61237296 AATTTAAACAGCATCTTACAAGG - Intergenic
1158840978 18:61386962-61386984 ATTTTACAAAGTTTTCTACAAGG + Intronic
1158905040 18:62003511-62003533 ATTTTATATAGCTACTTAAAAGG - Intergenic
1159693651 18:71524923-71524945 ATTCTAAACACTTTCTTGCAAGG - Intergenic
1159921820 18:74233330-74233352 GTTTGTTACAGTTTATTACATGG - Intergenic
1159943744 18:74428300-74428322 AATTTATGCAGTTTCTTGGAAGG - Intergenic
1160082441 18:75741585-75741607 ATTTTAAACATTTTCTTTCAAGG + Intergenic
1160475827 18:79186840-79186862 ATTTTTCACAGTTTCTTGAAAGG + Intronic
1164770560 19:30805323-30805345 ATCTTATACATTTACTTAAAAGG + Intergenic
1166162229 19:40962868-40962890 ATTTTAAACAGTCTTTTACCAGG - Intergenic
1167257205 19:48437887-48437909 ATTTTATATAGATCCTAACAGGG - Intronic
1168193016 19:54753922-54753944 ATTTTAGACAGTTTCTGCTAAGG + Intronic
1168478865 19:56700011-56700033 ATGTTCCACAGTTTCTTTCATGG + Intergenic
1168555181 19:57332577-57332599 AATCTAGACAGTTTCTTAGAGGG + Intergenic
925187719 2:1860601-1860623 ATTTTATGCAGCTTGTTGCAGGG + Intronic
925749862 2:7078347-7078369 TTTTCTTACAGTTTCTGACACGG - Intergenic
925750652 2:7088456-7088478 ATCTTATATAGTATCTTACAGGG + Intergenic
927324014 2:21782159-21782181 ATTATTTACAGTTGCTTTCATGG - Intergenic
929653521 2:43706134-43706156 TATTTATACACTTTTTTACATGG - Intronic
931526704 2:63164245-63164267 TGTTTATACAGTGTCTGACATGG + Intronic
931960033 2:67472098-67472120 ATTTTACACATTTTTATACATGG + Intergenic
932202273 2:69840641-69840663 ATCTTATACAACTTCTTGCAAGG + Intronic
933071271 2:77860880-77860902 ATTCTATAAACTTTCTTAAATGG - Intergenic
933295039 2:80480204-80480226 ATTTTATGCATTTTCCTACATGG + Intronic
934526316 2:95053956-95053978 ATTTTATAAAGTATTTCACAGGG - Exonic
935105851 2:100042760-100042782 ACTTTATGAAGTTTCTAACATGG + Intronic
935657508 2:105437643-105437665 ACTTGATAAAGTGTCTTACATGG + Intronic
935948474 2:108307353-108307375 ATTTTATACCTTTACTTACCAGG + Intronic
936169781 2:110159328-110159350 ATCTTATACAAATTCTTCCAAGG - Intronic
936553300 2:113469861-113469883 ATTTGTTAAATTTTCTTACAAGG - Intronic
936860399 2:117010689-117010711 ATTTATTACTTTTTCTTACATGG + Intergenic
937116423 2:119408038-119408060 ATTTTATACACTGTTTTAAATGG - Intergenic
939130831 2:138234125-138234147 CTTTCATACAATTTCTGACATGG + Intergenic
939531557 2:143369396-143369418 ATTTTCTGCTTTTTCTTACAAGG + Intronic
939648141 2:144727310-144727332 ATATTATACTGATGCTTACAAGG + Intergenic
939673592 2:145043780-145043802 ATTCTATACGGTTTCTCAGAGGG + Intergenic
939826234 2:147018731-147018753 ATTTTTTACTGTTTTTTAGATGG + Intergenic
940124018 2:150303537-150303559 ATTATAAACATTTACTTACATGG - Intergenic
940138553 2:150466518-150466540 ATTAAATACAGTCTCTCACATGG - Intergenic
940617032 2:156061797-156061819 ATTTTATACTGATTGTAACATGG + Intergenic
940892999 2:159053644-159053666 ATTGTATAAAGCTTGTTACACGG - Intronic
940932597 2:159452038-159452060 AATTTATTCAGTTTCTAGCATGG - Intronic
941320092 2:164043474-164043496 TTTTTAAAAAATTTCTTACAAGG - Intergenic
941422241 2:165296902-165296924 ATGTTATACACTATTTTACAGGG + Intronic
941858770 2:170256288-170256310 ATCTTATATAGTATCTCACAGGG - Intronic
942114180 2:172712171-172712193 ATTTGTTACAATTTATTACAGGG - Intergenic
942169694 2:173277702-173277724 AATTTACACAGTTTGCTACAAGG + Intergenic
942332491 2:174841672-174841694 ATTTTAAATAATTTCTTACTTGG - Intronic
942936118 2:181558333-181558355 ATATTATTCACTTTATTACAAGG - Intronic
943080750 2:183256118-183256140 ATTTTTTAAAGTTTTCTACAAGG + Intergenic
943426554 2:187744443-187744465 ATTTTATACAATTTTTTATTTGG - Intergenic
943894329 2:193334072-193334094 ATTTTTAACAGTTACTTTCATGG + Intergenic
945462753 2:210129587-210129609 ATATGCTACAGTTTATTACATGG - Intronic
945559614 2:211322440-211322462 ATTTTATACATTTTCTTTTTGGG - Intergenic
945703541 2:213200844-213200866 ATTTTATATGGTTTCTCAGATGG - Intergenic
945983582 2:216336793-216336815 CATTTTTACAGTTTCTAACAAGG - Intronic
946097338 2:217286685-217286707 GTTTTGTACAGTTTCATATATGG + Intronic
946989263 2:225309512-225309534 ATCTTATTGAGTTTGTTACAAGG + Intergenic
947319423 2:228899290-228899312 GTTCTATTCAGTTTCTTACCTGG - Intronic
948156299 2:235785549-235785571 ATTTTGTGTAGTTTCTTACCTGG + Intronic
948629965 2:239295919-239295941 ATTTGCAACAGCTTCTTACAGGG + Intronic
1169653689 20:7897938-7897960 ATTTCCTGCATTTTCTTACATGG - Intronic
1169761650 20:9101459-9101481 ATTGTATAGAGTTTGTTACTGGG - Intronic
1169995659 20:11553334-11553356 ATTTTATACATTTTCCACCATGG - Intergenic
1170050866 20:12143961-12143983 ATCTTGTACAGTATCTCACAGGG + Intergenic
1170255438 20:14337844-14337866 ATTTTCTAAAGTTTACTACAAGG + Intronic
1170401594 20:15990885-15990907 GTTTTATAAATTTTCTTAGAAGG + Intronic
1170594733 20:17796619-17796641 ACTTTATACAGTGTCTTAGAAGG + Intergenic
1170690440 20:18610530-18610552 ATTATACACAGTTTTTTAAAAGG + Intronic
1172457031 20:35085278-35085300 TATTTATACATTGTCTTACAAGG + Intronic
1177210080 21:18060036-18060058 ATTTCAAACACTTTCTTCCAAGG + Intronic
1177448599 21:21234407-21234429 ATTTAATATATATTCTTACAAGG - Intronic
1177844497 21:26272643-26272665 ATCTTTTACAGTTTCCAACAAGG + Intergenic
1178283999 21:31309745-31309767 TTTTCATATAGTTTCTTATAGGG - Intronic
1178978048 21:37237393-37237415 TTTTCATTCAGTTTCTTTCAGGG + Intronic
1179425893 21:41278121-41278143 ATTTTCCACAGTGTATTACAAGG - Intronic
1182877784 22:33707350-33707372 ATTTTATAAATTTTGTTATAGGG - Intronic
1183003196 22:34878837-34878859 ATTTTATAATGTTTATTTCAGGG + Intergenic
949247807 3:1945908-1945930 ATTTTATACATTTTCAAAAATGG + Intergenic
949754756 3:7396201-7396223 ATTTTTTAAAGGTTCTTACTGGG - Intronic
949944860 3:9181871-9181893 ATTTTAAAAAGGGTCTTACATGG + Intronic
950137193 3:10589867-10589889 AGTTTGTGCAGTTTCTTATAAGG + Intronic
950588478 3:13915823-13915845 ATTTTATATTGTATCTTAGAAGG - Intergenic
951393326 3:22133960-22133982 ATTCTATGCAGTTTCTTATATGG - Intronic
952245185 3:31580983-31581005 ATATTATATAGTTTATTAAAAGG - Intronic
952337594 3:32417837-32417859 ATTTTAGACAGGTTCTCACCTGG + Intronic
952560823 3:34591541-34591563 ATTTTATATAATATCTCACAGGG + Intergenic
952642166 3:35610484-35610506 ATTTGATGCAGTTTCTTCCTAGG - Intergenic
953163839 3:40446487-40446509 ACTTAATACAGCTTCCTACATGG - Intergenic
953199749 3:40768265-40768287 ATTTTCTGCAGTTTCTTTGAAGG + Intergenic
953374001 3:42413447-42413469 CTTTTATGGTGTTTCTTACAGGG - Intergenic
954009075 3:47619016-47619038 ATTTTACAGATTTTCTTAGAGGG - Intronic
954954749 3:54509223-54509245 ATTTTAAACAGCTTTTTATAAGG - Intronic
957013979 3:75042226-75042248 ATTTCGTATAGCTTCTTACAAGG + Intergenic
957307270 3:78473760-78473782 ATCTTATATAGTATCTCACAAGG - Intergenic
957901328 3:86497213-86497235 ATTTTAAATGGTTTCTCACAAGG + Intergenic
958983329 3:100751146-100751168 TATTTATACAGTTACTTGCAAGG + Intronic
959261944 3:104093409-104093431 ACTTTATACACTTTTTTAAAGGG + Intergenic
959279927 3:104324736-104324758 ATCTTATATATTTTCTTTCATGG - Intergenic
959316863 3:104820555-104820577 ATTTTGTAAAATTTCTTAGAAGG - Intergenic
959823311 3:110763332-110763354 ATTTTATACATTTACATTCAAGG + Intergenic
960116711 3:113902266-113902288 ATTTTATAGGCTTTTTTACATGG + Intronic
960293996 3:115920028-115920050 ATATTATTCAGTTACTGACAAGG - Intronic
960352375 3:116608804-116608826 GTTTCAAACAGTTTATTACATGG - Intronic
960794227 3:121467726-121467748 TTTTTATTAAGTTTCTTAGACGG - Intronic
961076954 3:123991684-123991706 CTATTATACGGTTTCTTACCCGG - Intronic
961307627 3:125969627-125969649 CTATTATACGGTTTCTTACCCGG + Intronic
961632431 3:128311083-128311105 ATTTTAAAAATTTTCTTAGAAGG - Intronic
962772645 3:138627506-138627528 ATTTAATACATTTTCTTTTAGGG + Intronic
962955365 3:140261330-140261352 ATTTTACACTGTTGCTTAGATGG + Intronic
962993998 3:140606829-140606851 ATCTTATATAGTATCTTGCAGGG - Intergenic
963347263 3:144109963-144109985 ATTTTATGGTGGTTCTTACAAGG + Intergenic
963532746 3:146491343-146491365 TTCTTGTACAGTATCTTACAGGG + Intronic
963849598 3:150197359-150197381 TGTTTATACATTTTCTTAAATGG - Intergenic
964328903 3:155578736-155578758 ATTTGATGCAGTTTAGTACACGG + Intronic
964816367 3:160721351-160721373 ATCTTGTATAGTATCTTACAGGG - Intergenic
965916805 3:173858387-173858409 ATTTCAGACAGTTTTTTTCAAGG + Intronic
966504454 3:180683894-180683916 ATTTTATACAGTTCAGTAGATGG - Intronic
966695105 3:182781478-182781500 ATTGTATACAGTGGATTACAAGG + Intergenic
967659759 3:192092182-192092204 ATCTTGTATAGTATCTTACAGGG - Intergenic
967660919 3:192108874-192108896 ATTTTATCCAGAATCTTAGAGGG - Intergenic
968344082 3:197985775-197985797 ATTTTGAACTTTTTCTTACAGGG + Exonic
969837248 4:9852044-9852066 ATCTTATATAGTATCTCACAGGG - Intronic
970875213 4:20861220-20861242 AGTTTAAAGAGTTGCTTACAGGG - Intronic
971584723 4:28390851-28390873 ATTTTTAATAGTTTCTTTCACGG + Intronic
971746059 4:30582992-30583014 ATTTTCTCCAGTATTTTACAAGG + Intergenic
971751760 4:30658674-30658696 ATTTTAAATAGTTTCTTTCATGG + Intergenic
971782403 4:31053824-31053846 ATTTTATATACTTTGTTAAATGG - Intronic
971803021 4:31317267-31317289 ATTTTATAAAGTGTCTTAGGAGG + Intergenic
971884478 4:32425439-32425461 ATTTTATGTATTTTTTTACAAGG + Intergenic
972215178 4:36889979-36890001 ATCTTATACAGTATCTCACAGGG + Intergenic
972282205 4:37613249-37613271 ATTTTATACAGTTTCTATCATGG - Exonic
972402296 4:38716964-38716986 ATTTTATAATGTTTTTTATATGG + Intergenic
973247134 4:48020918-48020940 AAATTATCCAGTTTATTACATGG - Intronic
973936533 4:55852272-55852294 ATTTCATAAAGCTTCTTAGAAGG + Intergenic
974318203 4:60309447-60309469 ATTTAAAACAGTTTCTTAGATGG + Intergenic
974462739 4:62208878-62208900 ATTTTAAACAGATTCTTTTAAGG + Intergenic
974496165 4:62631310-62631332 ATCTTGTACAGTATCTCACAGGG - Intergenic
975317297 4:72969210-72969232 CTTTTTGACAGGTTCTTACAAGG + Intergenic
975541130 4:75513547-75513569 TTTTTGTACTGTTTCTTGCAAGG + Intronic
976176997 4:82364651-82364673 AGTTTATATATTTTTTTACATGG - Intronic
976342485 4:83960669-83960691 AGTTTATACAGCTTCTCAGAAGG + Intergenic
977130659 4:93232826-93232848 AAATTATACCATTTCTTACATGG + Intronic
977820531 4:101466971-101466993 ATTTGCTACCATTTCTTACATGG + Intronic
978143374 4:105343117-105343139 TTTTTAAACATTTTCTTAGAAGG + Intergenic
978309596 4:107371629-107371651 ATTTTCTACAATCTCTTTCAGGG + Intergenic
978425258 4:108575652-108575674 AGTTTCTCCAGTTTCATACAAGG - Intergenic
978461275 4:108956168-108956190 ATTTTATTTAGTTTTTTAAAAGG + Intronic
979008169 4:115331415-115331437 CTTTAAGACAGTTTCTTTCAGGG - Intergenic
979030375 4:115635947-115635969 ATTTTATACAATTTATTAACAGG - Intergenic
979439925 4:120739481-120739503 TTTTTCTACAGTTTTTTAAATGG - Intronic
979731390 4:124027260-124027282 ATTATATACATTTTGTTACAAGG + Intergenic
979769420 4:124504284-124504306 ATTATTTCCAGTTTCTTTCACGG + Intergenic
979885421 4:126022054-126022076 ACTTTATACTGTTTCTTTCTAGG - Intergenic
981337510 4:143583460-143583482 GTCTTATACAGTATCTTAAAGGG - Intronic
981352306 4:143745528-143745550 TTTTTAAACAGTATCTTAAAAGG + Intergenic
982088444 4:151860138-151860160 ATTCTTTGGAGTTTCTTACAAGG + Intergenic
982206427 4:153000535-153000557 ATTTTATACAGCTCCTCCCAAGG - Intergenic
982233247 4:153228441-153228463 AATCTATACAGTTTCGTAGAGGG + Intronic
982381057 4:154747987-154748009 GTTTTCTACAGTGGCTTACATGG - Intronic
982642313 4:157978665-157978687 ATTTTATAGAGTGACTTATAGGG - Intergenic
983826840 4:172273069-172273091 AGTTTAAACAGTTTCTTAGAGGG - Intronic
983975683 4:173931141-173931163 ATTTTGCACAGTCACTTACAAGG + Intergenic
984032863 4:174626344-174626366 ATTTTATACAGTTCCTTTCTAGG + Intergenic
984797697 4:183679647-183679669 ATTGTATACAGTTCCTTAATGGG + Intronic
984988123 4:185351283-185351305 ATCTTATATAGTTTGTTTCAGGG + Intronic
985422880 4:189802176-189802198 ATTTTAAACAATTTCTTTCATGG - Intergenic
987052202 5:14156947-14156969 ATTTCATACAGTTTATAAAAAGG + Intronic
987572016 5:19676346-19676368 ATCTTATATAGTATCTCACAGGG - Intronic
987807874 5:22793499-22793521 ATTGTATACTGTCTCTTACGTGG + Intronic
990662916 5:58038433-58038455 ATTTAATAAAGTTTTTTTCATGG + Intergenic
992022949 5:72642825-72642847 ACTTTATGAAGTTTCTCACATGG + Intergenic
992187814 5:74260844-74260866 ATGCTAAACAGTTTCTTAGAGGG - Intergenic
992413990 5:76535361-76535383 ATTTTATACCATACCTTACAGGG - Intronic
992763503 5:79972796-79972818 ATATTATACAGTTTCTCAGGAGG - Intergenic
992862536 5:80926854-80926876 ATTTTGTTCAGTTACTTATATGG + Intergenic
993207692 5:84905242-84905264 ATATTCTACAGTTGCTTATAGGG + Intergenic
993625854 5:90224050-90224072 ATCTTATATAGTTTCTCAGAAGG + Intergenic
994257959 5:97622755-97622777 ATTTTGTACAGTATCTCACAGGG + Intergenic
994448770 5:99912603-99912625 ATTTTCTATAGTTTCTCACATGG - Intergenic
994697683 5:103092927-103092949 TTTTGAGACAGGTTCTTACATGG - Intronic
994703965 5:103175961-103175983 ATTACTTACAGATTCTTACAAGG - Intronic
994830041 5:104769668-104769690 AGTTTATACACTTTCCTACAAGG + Intergenic
994850366 5:105047318-105047340 ATTTAATACAGTGTCTGTCAGGG + Intergenic
995716798 5:115088338-115088360 ATTTTCCACAGTTTCTTAGAAGG + Intergenic
996142934 5:119936406-119936428 ATGACATACTGTTTCTTACAAGG + Intergenic
996225278 5:120985591-120985613 ATTTTATACAGACTCTGAGATGG + Intergenic
996297056 5:121931632-121931654 ATGTTATACATTTTCTACCATGG - Intergenic
996916352 5:128716384-128716406 ATAATATACAGTTTTTTAAAAGG - Intronic
1000461707 5:161529870-161529892 ATTATAAACACATTCTTACATGG + Intronic
1001726486 5:173906704-173906726 ATTTGTTACAGTTTAATACAGGG - Intronic
1002814490 6:667237-667259 ATCTTTTAGTGTTTCTTACAAGG + Intronic
1004745048 6:18501464-18501486 ATGTTATAGAGTTTCTTAGAAGG + Intergenic
1007203325 6:40129657-40129679 ATTTTATTCAGATTCTAGCAGGG - Intergenic
1008345001 6:50415924-50415946 ACTTTTTGCAGTTTCTTATAAGG + Intergenic
1010259213 6:73796039-73796061 ATTTCATACAGGTTTTTAGAGGG - Intronic
1010317192 6:74465271-74465293 ATCTTATATAGTATCTCACAGGG + Intergenic
1010351115 6:74875174-74875196 ATTTTGTTTTGTTTCTTACAAGG - Intergenic
1011325089 6:86141890-86141912 CTTTTATAGAGTTTCTTATGAGG + Intergenic
1011616809 6:89204784-89204806 ATTTTCTAAATTTTTTTACATGG - Intronic
1011972259 6:93240989-93241011 ATTTTTTACAGCTCTTTACAGGG - Exonic
1012073304 6:94651362-94651384 ATTTTATAGATTTCATTACATGG - Intergenic
1012256352 6:97037170-97037192 ATTTTAGAAAATTTCTTAAATGG + Intronic
1013470218 6:110457510-110457532 ATTTTATATATTTTATTATATGG - Intronic
1014148638 6:118027709-118027731 ATTGTAAACAGTATCTGACAAGG - Intronic
1014316334 6:119870355-119870377 ATTTTAAACATTTTCTTGAAGGG + Intergenic
1015264089 6:131272291-131272313 ATTTTATAGATTTTTTTTCAAGG + Intronic
1015362916 6:132360985-132361007 ATTATTAACAGTTACTTACATGG + Intronic
1016475211 6:144419682-144419704 ACTTTATTTAGTTTTTTACAAGG - Intronic
1017610501 6:156181140-156181162 GTTTTCTTCAGTTTCTTTCATGG + Intergenic
1018881006 6:167880514-167880536 ATTTGATAAAGTTCCTTACCCGG - Exonic
1020419323 7:7983211-7983233 ATTTTATACAGTTTCTTACATGG - Intronic
1021054731 7:16034056-16034078 ATTTTATACTGTTTGTTGTAGGG - Intergenic
1021076763 7:16314570-16314592 ATTTTGAACATTTTTTTACAAGG + Intronic
1021411570 7:20334928-20334950 ATTTTTTAAAGTTTTTAACATGG + Intronic
1021466023 7:20944439-20944461 ATATTATACAGTATATTAAAAGG + Intergenic
1022587711 7:31631440-31631462 ATTTTAGTCATTTTCTTACGTGG + Intronic
1023311492 7:38891530-38891552 CTTTTACACAGTTACATACATGG + Intronic
1024521463 7:50308395-50308417 ATTTTTAACAGTTTATTACCAGG - Intronic
1024719712 7:52121598-52121620 ATTTTACAAAGTTTCTTCCTTGG + Intergenic
1025775398 7:64556679-64556701 ATTTTTTAGATTTTCTTTCAGGG - Intronic
1026339886 7:69426055-69426077 TTTTTATACAGTGCCTAACACGG + Intergenic
1027599180 7:80217186-80217208 GTTTCATACAGTTTCATTCATGG - Intronic
1027822369 7:83063160-83063182 ATTTTATTCAATTTCTTCCAAGG - Intronic
1027968548 7:85045407-85045429 ATATTATACATTTTCTTAAAAGG - Intronic
1028056113 7:86245828-86245850 ATTTGAGATAGTTTATTACAAGG - Intergenic
1028255288 7:88588367-88588389 ATTTTATTCCATTTCTCACATGG - Intergenic
1028370700 7:90088527-90088549 ATTTTGTATAGTATCTCACAGGG - Intergenic
1028638589 7:93018195-93018217 ACTTTCTACAGTTTCTCAAAAGG - Intergenic
1028861112 7:95651573-95651595 ACTTTATACAATTTTTTAAAGGG - Intergenic
1030020622 7:105271806-105271828 ATTTTATTCAATTACTTCCAGGG + Intronic
1031211592 7:118835653-118835675 ATTTTCTATAGTTTCATAAAGGG - Intergenic
1031222468 7:118987336-118987358 ATTTTACTCACTTTCTTATAAGG + Intergenic
1032561325 7:132896170-132896192 ATTTTATATATTTTCTCACTGGG - Intronic
1032624549 7:133576496-133576518 ATTTAAAACGTTTTCTTACATGG + Intronic
1033807023 7:144965922-144965944 ATTTCATAAAGTTACTTAAAGGG + Intergenic
1034923621 7:155103435-155103457 ATTCTACACAGTTCCTCACAGGG - Intergenic
1035347884 7:158218093-158218115 ATCTTATATAGTATCTCACAGGG - Intronic
1035526819 8:319997-320019 ATTTTATTCTGTTCCTTTCAAGG + Intergenic
1035703661 8:1657012-1657034 ATTTTATAGTGTTGTTTACATGG + Intronic
1036468400 8:9025380-9025402 ATTTTCTCCAGCTTCTTATAGGG + Intronic
1037206374 8:16325242-16325264 ATTTTGTTCATTTTCTGACAAGG - Intronic
1037324607 8:17676000-17676022 ATTACATACAGTTCCTTAAAAGG + Intronic
1037824137 8:22150797-22150819 ATTTTAGAAAGCTTCTTGCATGG - Intronic
1039213643 8:35243222-35243244 ATTTTAAAAATATTCTTACATGG - Intronic
1040099443 8:43485089-43485111 ATTGTCTACATTTTCTTCCAGGG - Intergenic
1040793006 8:51255559-51255581 GTTTAATAAAGTTTCTTACATGG + Intergenic
1041150227 8:54924809-54924831 ATTTAATGCAGCTTCTTATATGG + Intergenic
1041414861 8:57596694-57596716 ACTTTAAACAGCTTCTTTCAGGG - Intergenic
1043001658 8:74767369-74767391 ATTTAATACCCTTTCTCACAAGG - Intronic
1043122196 8:76340606-76340628 ATTCTATATAGTTTCTTCAATGG + Intergenic
1043558369 8:81460713-81460735 TTTGTATACAGTTTACTACAAGG + Intronic
1043696129 8:83220457-83220479 ATCTTATAGAGTATCTCACAAGG + Intergenic
1044044803 8:87418348-87418370 ATTTTATTTAATTTTTTACATGG - Intronic
1044263821 8:90159478-90159500 ATTTTATACTGTTTATTCCTTGG - Intergenic
1044349377 8:91145783-91145805 ATTTTCTGCTGTTTCTTATATGG + Intronic
1045437875 8:102182561-102182583 AGTTTATAAAGTTTCTTCCCTGG - Intergenic
1045487638 8:102644580-102644602 CTTTTATTCAGTTTCATATAAGG + Intergenic
1045743921 8:105394493-105394515 ATTCTATACAGTGTTCTACAAGG - Intronic
1046090651 8:109499489-109499511 ATGTTATACAATTTCCTCCAAGG - Intronic
1047602138 8:126436156-126436178 ATTTTATGCATTTTTTTAAAAGG - Intergenic
1048921094 8:139230859-139230881 CTGTTATGTAGTTTCTTACATGG - Intergenic
1049899701 9:147306-147328 ATTTGTTAAATTTTCTTACAAGG + Intronic
1049937005 9:508806-508828 ATAGTTTCCAGTTTCTTACATGG + Intronic
1050150043 9:2610398-2610420 ATTCTATAAACTTTCTTCCATGG + Intergenic
1050664436 9:7919383-7919405 ATTTTATATGGTTTCTCAGAAGG + Intergenic
1051095825 9:13464126-13464148 GTTTCATACAGTCTCTCACAGGG + Intergenic
1051096779 9:13475786-13475808 ATCTTGTATAGTTTCTCACAGGG + Intergenic
1051351314 9:16200419-16200441 ATTTTATGCAGTGTTTTTCAGGG - Intergenic
1051652924 9:19348000-19348022 ATACTATACAATTTCATACAAGG - Intronic
1051819510 9:21148621-21148643 ATTTTGTATAGTTTCTTGCTGGG + Intergenic
1051885842 9:21891777-21891799 ATTTTGTATAGTATCTTACAGGG - Intronic
1052097898 9:24407079-24407101 AATTCATACACTTTCTTAAATGG - Intergenic
1052608052 9:30731426-30731448 ATTTAATTCAGTTTATTATATGG + Intergenic
1053467368 9:38318676-38318698 ATCTGATACTGTGTCTTACATGG - Intergenic
1053742748 9:41157590-41157612 ATTTGTTAAATTTTCTTACAAGG + Intronic
1054445754 9:65313776-65313798 ATTTGTTAAATTTTCTTACAAGG + Intergenic
1054484515 9:65707729-65707751 ATTTGTTAAATTTTCTTACAAGG - Intronic
1054685593 9:68273708-68273730 ATTTGTTAAATTTTCTTACAAGG - Intronic
1055385174 9:75753802-75753824 ATTTTATACAGATTCAAATAAGG - Intergenic
1056553487 9:87670745-87670767 CTGTAATACAGTTTCTTAGATGG - Intronic
1056720917 9:89071103-89071125 CTTTTTTACAGTGTCTTGCAAGG + Intronic
1057373653 9:94498035-94498057 ATTTTGAACTTTTTCTTACAGGG + Intergenic
1057499825 9:95587907-95587929 ACTTTGTACAGTTACTTTCATGG + Intergenic
1059097586 9:111435275-111435297 GTTTTATACTTTTTCTTCCAAGG - Intronic
1059890914 9:118802965-118802987 ATTTTATATAGTATTGTACAAGG - Intergenic
1059979275 9:119751901-119751923 ATTTTAGACACTTTCTTTCAGGG + Intergenic
1185568480 X:1114698-1114720 ATTATATTCAGTTCCTTCCAGGG - Intergenic
1185579835 X:1203369-1203391 ATTATATTCAGTTCCTTCCAGGG - Intronic
1185917236 X:4048872-4048894 CATTTATACATTTTCTTAAAGGG + Intergenic
1186551915 X:10515304-10515326 ATTTTCTACAATTTCTTACAAGG + Intronic
1187251290 X:17600563-17600585 AATTTGTACAGTTTCCTGCAAGG - Intronic
1187553540 X:20329444-20329466 TCTTTATGCATTTTCTTACACGG - Intergenic
1187754967 X:22513925-22513947 AATTTGTACAGATTCTTATAGGG - Intergenic
1187801500 X:23068399-23068421 ATCTTGTACAGTATCTTGCAAGG - Intergenic
1188336421 X:28939598-28939620 TTTTTATACAGATTATTTCATGG - Intronic
1188959660 X:36475264-36475286 ATTTCATAGATTATCTTACAGGG - Intergenic
1189021677 X:37348531-37348553 CTTTTATTCTGTTTCTTAGAGGG + Intergenic
1189102359 X:38204464-38204486 ATTCAGTACAGTTTATTACATGG + Intronic
1189207289 X:39252846-39252868 ATTCTACACAGTTTCTCAGAGGG - Intergenic
1191177023 X:57515368-57515390 ATTTTTTATAGTATCTCACAGGG + Intergenic
1193189677 X:78554881-78554903 ACTTTATAGAGTTTCTGGCAAGG + Intergenic
1193364110 X:80609961-80609983 ATCTTATATAGTATCTTGCAGGG - Intergenic
1193850858 X:86535982-86536004 ATTTTATAAATTGTGTTACAAGG + Intronic
1193864697 X:86716916-86716938 ATTTTATACAACTTTTTAAAAGG + Intronic
1193918122 X:87392425-87392447 AATTTATATAAATTCTTACATGG + Intergenic
1194801516 X:98279399-98279421 ATATAATAACGTTTCTTACAAGG + Intergenic
1195155333 X:102117079-102117101 ATCTTGTATAGTTTCTCACAGGG - Intergenic
1195314177 X:103661673-103661695 CTGTTATACAGTTCATTACAAGG + Intergenic
1195496666 X:105543271-105543293 ATTTTCTCTGGTTTCTTACAGGG - Intronic
1195610528 X:106862229-106862251 ATCTTATATAGTATCTTGCAGGG + Intronic
1197228382 X:123976481-123976503 ATATTATACAGGTTCTCAAATGG + Intronic
1197374515 X:125665239-125665261 ATTTTGTATAGTATCTCACAGGG - Intergenic
1197600791 X:128526133-128526155 ATTTTCTATAGTATCTCACAGGG - Intergenic
1198915260 X:141663652-141663674 TTTTTAAACAGTTTTTTTCAGGG - Intronic
1199611080 X:149614525-149614547 ATTTCCTTCCGTTTCTTACATGG - Intronic
1199765093 X:150935700-150935722 ATTTAATACAGTGACTCACAGGG + Intergenic
1199826097 X:151501823-151501845 ATTTTATCCATTTTCTTAATTGG - Intergenic
1200942458 Y:8799336-8799358 TTTTTAAACAGTTTTTTTCAAGG - Intergenic
1201332157 Y:12836417-12836439 ATTTGATACAGTTTATTAGGTGG - Intronic
1201722280 Y:17112733-17112755 ATTTTATTCACTCTCTCACATGG - Intergenic