ID: 1020419326

View in Genome Browser
Species Human (GRCh38)
Location 7:7983237-7983259
Sequence ATGTAGGAATTTTAGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020419322_1020419326 16 Left 1020419322 7:7983198-7983220 CCTCTGACTATAACCATGTAAGA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1020419326 7:7983237-7983259 ATGTAGGAATTTTAGGAAATAGG No data
1020419323_1020419326 3 Left 1020419323 7:7983211-7983233 CCATGTAAGAAACTGTATAAAAT 0: 1
1: 0
2: 4
3: 34
4: 450
Right 1020419326 7:7983237-7983259 ATGTAGGAATTTTAGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020419326 Original CRISPR ATGTAGGAATTTTAGGAAAT AGG Intronic
No off target data available for this crispr