ID: 1020430128 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:8110124-8110146 |
| Sequence | TAGTAGTCATGGTGGGAAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020430128_1020430134 | 12 | Left | 1020430128 | 7:8110124-8110146 | CCCATTTCCCACCATGACTACTA | No data | ||
| Right | 1020430134 | 7:8110159-8110181 | ATCCCCCAAAGTTCATGTGTTGG | 0: 9 1: 107 2: 311 3: 522 4: 757 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020430128 | Original CRISPR | TAGTAGTCATGGTGGGAAAT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||