ID: 1020430128

View in Genome Browser
Species Human (GRCh38)
Location 7:8110124-8110146
Sequence TAGTAGTCATGGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020430128_1020430134 12 Left 1020430128 7:8110124-8110146 CCCATTTCCCACCATGACTACTA No data
Right 1020430134 7:8110159-8110181 ATCCCCCAAAGTTCATGTGTTGG 0: 9
1: 107
2: 311
3: 522
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020430128 Original CRISPR TAGTAGTCATGGTGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr