ID: 1020430134

View in Genome Browser
Species Human (GRCh38)
Location 7:8110159-8110181
Sequence ATCCCCCAAAGTTCATGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1706
Summary {0: 9, 1: 107, 2: 311, 3: 522, 4: 757}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020430131_1020430134 5 Left 1020430131 7:8110131-8110153 CCCACCATGACTACTATGGTTTG No data
Right 1020430134 7:8110159-8110181 ATCCCCCAAAGTTCATGTGTTGG 0: 9
1: 107
2: 311
3: 522
4: 757
1020430129_1020430134 11 Left 1020430129 7:8110125-8110147 CCATTTCCCACCATGACTACTAT No data
Right 1020430134 7:8110159-8110181 ATCCCCCAAAGTTCATGTGTTGG 0: 9
1: 107
2: 311
3: 522
4: 757
1020430133_1020430134 1 Left 1020430133 7:8110135-8110157 CCATGACTACTATGGTTTGAATA No data
Right 1020430134 7:8110159-8110181 ATCCCCCAAAGTTCATGTGTTGG 0: 9
1: 107
2: 311
3: 522
4: 757
1020430132_1020430134 4 Left 1020430132 7:8110132-8110154 CCACCATGACTACTATGGTTTGA No data
Right 1020430134 7:8110159-8110181 ATCCCCCAAAGTTCATGTGTTGG 0: 9
1: 107
2: 311
3: 522
4: 757
1020430128_1020430134 12 Left 1020430128 7:8110124-8110146 CCCATTTCCCACCATGACTACTA No data
Right 1020430134 7:8110159-8110181 ATCCCCCAAAGTTCATGTGTTGG 0: 9
1: 107
2: 311
3: 522
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020430134 Original CRISPR ATCCCCCAAAGTTCATGTGT TGG Intergenic
900017478 1:162672-162694 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
900047737 1:521268-521290 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
900069951 1:763132-763154 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
900698036 1:4024445-4024467 TTCCCCCAAAATTCATATTTGGG + Intergenic
900723999 1:4202922-4202944 GTTCCCCACAGTTCATATGTTGG - Intergenic
900821332 1:4891271-4891293 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
900864300 1:5256248-5256270 ATCCCCCAAAGTTCACATATTGG + Intergenic
900909180 1:5582618-5582640 ATCCTTCAAAGTTCATGTGTTGG + Intergenic
900963381 1:5940111-5940133 GTCCCCCAAAAGGCATGTGTTGG + Intronic
901168879 1:7240042-7240064 TCCCCCTAAAGGTCATGTGTTGG - Intronic
901468696 1:9440702-9440724 GTCCCCCAACATCCATGTGTTGG - Intergenic
902060799 1:13640896-13640918 TCCCCCCAAAATTCATGTGGTGG - Intergenic
902143441 1:14376271-14376293 GTCCCCCAAAGTTTATGTGTTGG + Intergenic
902415101 1:16233817-16233839 GTCCCCCAGAGTTCATGTGTTGG + Intronic
903030452 1:20460311-20460333 GTCTTCCAAAGCTCATGTGTTGG + Intergenic
903031906 1:20469745-20469767 GTCCCCTAAAGCTCATGTGTTGG - Intergenic
903709242 1:25310197-25310219 GTCCCCCAAATTTCATGTGCTGG + Intronic
903709597 1:25313038-25313060 ATCCCTCAAATTTCATGTGTTGG + Intronic
903717519 1:25379347-25379369 ATCCCTCAAATTTCATGTGTTGG - Intronic
903842244 1:26251691-26251713 TCCCCCAAAAGTTCATGTGTTGG - Intronic
904079587 1:27863590-27863612 GTCCTCCAAATTTCAGGTGTTGG + Intergenic
904315835 1:29662391-29662413 GTTCTCCAAATTTCATGTGTTGG + Intergenic
904320123 1:29691184-29691206 GTCCCCCAAAGCTCACATGTAGG + Intergenic
904436701 1:30503622-30503644 ATCTCCCAAAATTCATGTATTGG + Intergenic
904610268 1:31722052-31722074 GTCCCCCAAAAAGCATGTGTTGG + Intergenic
904691386 1:32295702-32295724 GTCCCCCAAAATTCATGTGTTGG - Intronic
904902985 1:33872058-33872080 GTCCCCCAAATGTCATGTGCTGG - Intronic
904935409 1:34126512-34126534 ATCCCCCAAGTATTATGTGTGGG + Intronic
904985516 1:34545096-34545118 GTTTCCCAAATTTCATGTGTTGG + Intergenic
905011353 1:34749096-34749118 GTCCCCCAAAATTCATATGTTGG + Intronic
905382061 1:37569734-37569756 GTCCCCCAAAATTCATATGTTGG + Intronic
905472147 1:38201302-38201324 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
905509211 1:38505294-38505316 ATCCCCTATAGTGCATGTGGAGG + Intergenic
905696510 1:39978497-39978519 GTCCCCCAAATTTCACATGTTGG + Intergenic
905776963 1:40674513-40674535 GTTCCCCAAGGTTCATGTGCTGG + Intergenic
905837787 1:41143154-41143176 AAACCCCAAAATTCATGTTTTGG + Intronic
905913198 1:41667882-41667904 ATCCCCCAAAGAGCTTGAGTTGG - Intronic
905967296 1:42109572-42109594 ATTCCCCAAATTTCATGTGTTGG + Intergenic
906308461 1:44736427-44736449 GTCCCCCAAATTTTATGTGCTGG - Intergenic
906682590 1:47739564-47739586 ATCACCCAAAGGACTTGTGTTGG + Intergenic
906807193 1:48790631-48790653 GCCCCTCAAAGTTCATGGGTTGG + Intronic
906892588 1:49733599-49733621 ATCCCCCCAAATTCACATGTTGG + Intronic
907083325 1:51644926-51644948 GTCCCCCAGCATTCATGTGTTGG + Intronic
907151270 1:52290371-52290393 ATCCCTCAAAAAGCATGTGTTGG - Intronic
907287279 1:53389948-53389970 TTCCCCCAAAATTCATATGTTGG - Intergenic
908034527 1:60037680-60037702 GTTTCCCAAAGTTCATGTGTTGG - Intronic
908307197 1:62832687-62832709 TCCCTCCAAAATTCATGTGTGGG - Intronic
908594984 1:65678337-65678359 GTCTCCCAAAAATCATGTGTTGG - Intergenic
908647771 1:66297755-66297777 GTCCCCCAAAGCACATGTGTTGG - Intronic
908706124 1:66956866-66956888 ATCACTCAAAATCCATGTGTGGG - Intronic
908804097 1:67912278-67912300 GTTCCCTAAAGTTCATGTTTTGG + Intergenic
908882804 1:68751674-68751696 GTCCCCCAAAGTTTAGGTATTGG + Intergenic
908924929 1:69242579-69242601 GTCCTCCAAAGTTCATGAATTGG + Intergenic
909145964 1:71931729-71931751 GTCCCCCAAAGTTCATGTGTTGG - Intronic
909206005 1:72758750-72758772 GTCCCCCAAACTTTATGTGTTGG - Intergenic
909407852 1:75312379-75312401 GTCCCCCAAGGTTCATGTGTTGG + Intronic
909418065 1:75430074-75430096 GTCCCCCAACATTTATGTGTTGG + Intronic
909455813 1:75847230-75847252 GATCCCCAACGTTCATGTGTTGG - Intronic
909513386 1:76479748-76479770 GTCCCCCAAAGTTCATCTGTTGG - Intronic
909542403 1:76805814-76805836 GTTCCCCAAAGTTTATGTGTTGG + Intergenic
909567592 1:77071269-77071291 GTCCACCAAAATTCATGTTTAGG - Intergenic
909581111 1:77236259-77236281 GTCCCTCAAAGTTCACGAGTTGG + Intergenic
909851311 1:80467760-80467782 GTCTCCCAAATTTCATATGTTGG + Intergenic
910000604 1:82337068-82337090 GTCTCCTAAAGTTCATGTGTTGG + Intergenic
910015468 1:82518543-82518565 GTCCCCCCAAATTCATGTGTTGG + Intergenic
910219391 1:84875345-84875367 GCCCCCCAGAGTTCATGTGTTGG + Intronic
910302042 1:85717025-85717047 TACCCCAAAAGTCCATGTGTTGG + Intergenic
910409062 1:86921459-86921481 CTCCCCCAAAATTCACATGTTGG + Intronic
910469599 1:87538011-87538033 ATCCCCCAAATTTTATGTGCTGG + Intergenic
910469871 1:87540345-87540367 GTCCCCCTAATTTCATGTGTTGG + Intergenic
910682657 1:89883198-89883220 ATCCCTCAAAATACGTGTGTAGG + Intronic
910688849 1:89945508-89945530 GTACCCCAAAGTTTATGTATTGG - Intergenic
910722911 1:90307269-90307291 GTTCTCCAAAGATCATGTGTTGG + Intergenic
911228052 1:95329175-95329197 GTCCCACAAAGTTCATATGTTGG - Intergenic
911264620 1:95728222-95728244 GTCCCTCAAAGTTCATGTGTTGG - Intergenic
911287843 1:96019187-96019209 GTTCCTCAAAGTTCATGTGTTGG - Intergenic
911534249 1:99080558-99080580 GTCCCCCAAAGTCCAAATGTTGG - Intergenic
911643821 1:100317706-100317728 ATTCCCCCAAATTCCTGTGTTGG + Intergenic
911687873 1:100797914-100797936 GTCTCCCAAATTTCATGTGTTGG + Intergenic
911713116 1:101097864-101097886 GTTTCCCAAGGTTCATGTGTTGG + Intergenic
912469930 1:109899639-109899661 TCCCCCAAAAGTTCATGTGTTGG - Intergenic
912864599 1:113246017-113246039 GTCCCTCAAAGTTCATGTGTTGG + Intergenic
913065837 1:115253926-115253948 TTCCCTCAAAATTCATATGTTGG + Intergenic
913090202 1:115471609-115471631 GTCCCCCAAAATTCACGTGTTGG + Intergenic
913197568 1:116470718-116470740 GTCCTCCAAAATTCATGTGTTGG + Intergenic
913415119 1:118596906-118596928 GTCCCCCAAATCTTATGTGTTGG - Intergenic
913435270 1:118841096-118841118 TTCCCCCAAAATTCATATATTGG - Intergenic
913531949 1:119739795-119739817 ATCCCCCAAAAGTTATGTCTAGG - Intronic
914231983 1:145771105-145771127 CTCCTCAAAAATTCATGTGTTGG + Intronic
914438137 1:147678878-147678900 GTCCCCTAAAGTTCATGCATTGG - Intergenic
914454013 1:147818571-147818593 TATCCCCAAAGTTCATGTGTTGG - Intergenic
915110329 1:153560541-153560563 GTTCCCCAAAGTTCATGTGTTGG - Intergenic
915257239 1:154643258-154643280 ATGTCCCAAAGTTCATGTGATGG - Intergenic
915877775 1:159630603-159630625 ATCCTCAAAAGATCCTGTGTGGG - Intergenic
916279790 1:163036985-163037007 GTCCCCCAAAGGTCATGTGTTGG - Intergenic
916350838 1:163848009-163848031 GTCCCCCAAAGTTCATACTTTGG - Intergenic
916737964 1:167624802-167624824 GTCCTCCAAAGTTTATTTGTTGG + Intergenic
916811264 1:168307549-168307571 GTCCCCCAAGGTTCATGTGTTGG - Intronic
916986946 1:170201861-170201883 GTCCCCCAAAAGGCATGTGTTGG - Intergenic
917110728 1:171544423-171544445 TCCCTCAAAAGTTCATGTGTTGG - Intronic
917173181 1:172200952-172200974 TTACCACAAAGTTCTTGTGTTGG + Intronic
917285604 1:173418898-173418920 GACCCCCAAATTTCATGTGCTGG + Intergenic
917614302 1:176723265-176723287 GTCCACAAAAGTTCATGTCTTGG - Intronic
917926723 1:179795329-179795351 TCCCCCAAAAGTTCATGTGCTGG + Intronic
918189733 1:182162659-182162681 GACCCCCAAAGTTCAGGTGTTGG + Intergenic
918327974 1:183428259-183428281 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
918387171 1:184021318-184021340 GTCCCCCAAAGTTCATGTGTTGG + Intronic
918387270 1:184022333-184022355 GTCCTCCAAAGTTCATGTGTTGG + Intronic
918553619 1:185773035-185773057 GTCCCCCAAAATTCATGTGCTGG - Intronic
918611561 1:186498167-186498189 GTCTCCCAAATTTCATGTGTTGG - Intergenic
918879669 1:190100845-190100867 GTCCCCCAAAGTTCATGTGCTGG + Intronic
919130373 1:193442978-193443000 GTCGCCTAAATTTCATGTGTTGG + Intergenic
919144425 1:193615491-193615513 GTCTCCCAAAATTCATATGTTGG - Intergenic
919159490 1:193809469-193809491 GTCTCCCAAAGTTTATGTGTTGG + Intergenic
919161826 1:193840359-193840381 GTCCCCTGAAGTTCATGTGTTGG - Intergenic
919162021 1:193842074-193842096 GTCCCTCAAAGTTCACATGTTGG - Intergenic
919344965 1:196363478-196363500 GTTCCCTAAAGTTCATGTGTTGG + Intronic
919398423 1:197080133-197080155 GTTCCCCAAAGTTCGTATGTTGG + Intergenic
919481841 1:198099785-198099807 GTCCCCCAGATTTCATGTGTTGG + Intergenic
919482314 1:198105654-198105676 TGTCCCCAAAGTTAATGTGTTGG + Intergenic
919485010 1:198134975-198134997 GTCCTCCGAAATTCATGTGTTGG + Intergenic
919656440 1:200201455-200201477 AGCCACCACAGTTCCTGTGTTGG + Intergenic
920041095 1:203097869-203097891 ATCCCCCAAAGTTCATGTGTTGG - Intronic
920050074 1:203159030-203159052 GTCCCCCAAAGCTCATGTGTTGG - Intronic
920252782 1:204632992-204633014 ATCCCACAAAATCCATGTATTGG + Intronic
920780534 1:208986907-208986929 GTACCCCAAAGTTCATGTGTTGG + Intergenic
920780544 1:208987051-208987073 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
921022836 1:211252243-211252265 TTCCCCCAAAATTCATATGTTGG + Intergenic
921072948 1:211677102-211677124 ATCCCCCAAAGTTCATGTGTTGG + Intergenic
921125065 1:212170348-212170370 GTCCCCCAGATTTCATGTGTTGG + Intergenic
921422742 1:214967310-214967332 GTTCCCTAAAGTTCAAGTGTTGG - Intergenic
921454384 1:215350247-215350269 GTCCTCCAAAGTTCATGTGTTGG - Intergenic
921700911 1:218267487-218267509 GTCCGCCAAAGTTCATGTGTTGG - Intergenic
922023431 1:221727897-221727919 GTCCCCCAAAGTTCATGTATTGG + Intronic
922105323 1:222508589-222508611 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
922203706 1:223428745-223428767 ATCTCCCAATGTTCATGTGTTGG - Intergenic
922217095 1:223528660-223528682 GTCCCCCCAAATTCATGTGTTGG - Intergenic
922265657 1:223981168-223981190 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
922297664 1:224265619-224265641 ATTCCCCAAATTTCACGTGTTGG + Intronic
922308848 1:224369040-224369062 ATTCCCCAAAGACCATGAGTGGG - Intronic
922309191 1:224372027-224372049 ATCCCCCAAAGACCATGAGTGGG - Intronic
922327911 1:224546137-224546159 TTCCCTTAAAATTCATGTGTTGG - Intronic
922414182 1:225405363-225405385 GTTCTCCAAAGTTCACGTGTTGG + Intronic
922708647 1:227808632-227808654 CCACCCAAAAGTTCATGTGTTGG + Intergenic
922715747 1:227870532-227870554 CCCCTCCAAAATTCATGTGTTGG + Intergenic
922995193 1:229951808-229951830 GTCCCCCAGATTTCATATGTTGG + Intergenic
923076633 1:230615233-230615255 GTCTCCCAAAGTTCACATGTGGG + Intergenic
923220252 1:231886207-231886229 TGTCCCCAAAGTTAATGTGTTGG - Intronic
923336428 1:232974894-232974916 GTCCCCCACATTTCATGTGTTGG - Intronic
923501279 1:234567038-234567060 GTCCCCCAAAGTTTATGTGTTGG + Intergenic
923755058 1:236784703-236784725 GTCCCCCAAAGTTCGTGTGTTGG - Intergenic
923880545 1:238099405-238099427 GACCTCCAAAATTCATGTGTTGG - Intergenic
923880622 1:238100282-238100304 GTCCCCCAAAGTTTATATGTTGG - Intergenic
924147683 1:241093866-241093888 ATCCCCCATAGCACATGTATTGG - Intronic
924347495 1:243086120-243086142 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
924498846 1:244616749-244616771 ATCCCTCAAAGTTCATGTGTTGG - Intronic
924542423 1:244993920-244993942 TATCCCCAAAGTTCGTGTGTTGG - Intronic
924690071 1:246339679-246339701 GTACCTCAAAGTTCATGTGCTGG + Intronic
1062868225 10:875809-875831 GTCCCCCAAAGTTCATGTGTTGG - Intronic
1062985589 10:1765802-1765824 GTCCCCCAAATTTCATGTGTTGG + Intergenic
1063058428 10:2526351-2526373 GTCCCCCCAAATCCATGTGTTGG + Intergenic
1063113474 10:3056073-3056095 GTCCCCCAAATTTCACGTGTTGG - Intergenic
1063235386 10:4109323-4109345 TTCTCCCAAAGCACATGTGTTGG - Intergenic
1063323732 10:5076224-5076246 GTTCTCCAAAGTCCATGTGTTGG + Intronic
1063345941 10:5312483-5312505 AGCCCCCAGATTTCATGTGTTGG - Intergenic
1063434006 10:6016061-6016083 ATCCCCCAGAGCTCAGGTGTTGG + Intronic
1063473470 10:6307779-6307801 GTCACCCAAAGTTCATGTGTTGG + Intergenic
1063520833 10:6739223-6739245 AGACCCCACAGCTCATGTGTGGG - Intergenic
1063825604 10:9894434-9894456 ATCCCCCAAATATCCTGTTTGGG + Intergenic
1063837809 10:10035596-10035618 GTCCTCGAAAGATCATGTGTTGG + Intergenic
1063920319 10:10926174-10926196 GTCCCCCACAATTCATGTGCTGG + Intergenic
1064026065 10:11849787-11849809 GTATCCCAAAGCTCATGTGTTGG + Intronic
1064197338 10:13255629-13255651 GCCCCCAAAACTTCATGTGTTGG - Intergenic
1064326964 10:14360282-14360304 ATTTCCCAAAGTTTATGTGTTGG - Intronic
1064328163 10:14370093-14370115 GTCCCCCAAAATTCTTGTGTTGG + Intronic
1064447919 10:15412905-15412927 TTCCCCCACAATTCATATGTTGG - Intergenic
1064499581 10:15955316-15955338 GTTCCCCAAATTTCATGTGTTGG - Intergenic
1064760751 10:18617713-18617735 GTCCCCCAATATTCATGTGCTGG + Intronic
1064787359 10:18913108-18913130 GTCCCCCAAATTGTATGTGTTGG + Intergenic
1064928742 10:20599755-20599777 GTCCCACAAAGTTCATGTGTTGG + Intergenic
1065051524 10:21797540-21797562 GTCTTCCAAAGTTCATTTGTTGG + Intronic
1065065247 10:21956354-21956376 ATTTCCGAAAGTTTATGTGTTGG - Intronic
1065146060 10:22769374-22769396 TTTCCCCAAATTTCATGTGCTGG - Intergenic
1065397677 10:25257338-25257360 GTCCCCCAAAGTTCATGTGTTGG - Intronic
1065619529 10:27566211-27566233 GTCCCCTAAAGTTCATGTATTGG - Intergenic
1065663408 10:28030831-28030853 ATCTCTCCAAATTCATGTGTTGG + Intergenic
1065710717 10:28514927-28514949 GTCCCCCAAAGTTCTTGTGTTGG + Intergenic
1065718074 10:28593337-28593359 ATCCCCTAAAGTTCTTTTATTGG - Intronic
1065731834 10:28716723-28716745 GTGCCCCAAAGTTCTTGTGCTGG + Intergenic
1065743013 10:28814004-28814026 GCCCCCCAAAGTTCATGTGTTGG - Intergenic
1065835075 10:29649780-29649802 GTCCCCCAGAGTTCATGTGCTGG + Intronic
1065906832 10:30262412-30262434 GTCCCCCGAAGTCCATGTGTTGG - Intergenic
1066132375 10:32407095-32407117 TCCCCACCAAGTTCATGTGTTGG + Intergenic
1066233197 10:33458711-33458733 ATCCCCAAAAGTTCATGTGTTGG + Intergenic
1066629706 10:37447116-37447138 ATTTCCCAAAGTTTATGTGTTGG + Intergenic
1066673396 10:37863017-37863039 GTTCTCCAAAGCTCATGTGTTGG + Intergenic
1066728858 10:38418750-38418772 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
1066757090 10:38722106-38722128 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1067221963 10:44350678-44350700 ATCCCCAACAATTCATGTGTTGG - Intergenic
1067282941 10:44886701-44886723 CCCCTCCAAAATTCATGTGTTGG + Intergenic
1067458009 10:46437260-46437282 GTCCCACAAAGTTTATGTGTTGG - Intergenic
1067629188 10:47947374-47947396 GTCCCACAAAGTTTATGTGTTGG + Intergenic
1067739753 10:48886358-48886380 GTCCCCCAAAATTCTTGTGTTGG + Intronic
1067913538 10:50371990-50372012 GTTCCCCAGAGTTCACGTGTTGG - Intronic
1067979403 10:51067116-51067138 CTCCCCCAAAGTTCATATGCTGG - Intronic
1067989513 10:51195008-51195030 TCCCTCCAAAGTTCACGTGTTGG - Intronic
1068065035 10:52120254-52120276 ATCCCCCAAAGTTCATGTGTTGG - Intronic
1068065280 10:52122365-52122387 ATCCCCCAGAATTTATGTCTTGG - Intronic
1068153839 10:53169880-53169902 GTCCCCTAAAGTTCATGTGTTGG + Intergenic
1068311908 10:55289720-55289742 TCCCCCAACAGTTCATGTGTTGG + Intronic
1068464775 10:57375670-57375692 GTCCTTCAAATTTCATGTGTTGG - Intergenic
1068484263 10:57636332-57636354 GCCCCCCAAAGTCCATGTGTTGG - Intergenic
1068698997 10:60000304-60000326 TTCCCACAAAGTTCATGTGTTGG + Intergenic
1068809615 10:61241373-61241395 GTCTCCGAAAATTCATGTGTTGG + Intergenic
1068976235 10:63013225-63013247 ATCTCTGAAAGTTTATGTGTTGG - Intergenic
1069075276 10:64032334-64032356 GTCCCTCAAAATTCATGTGTTGG - Intergenic
1069134017 10:64741722-64741744 TCCCCCAAAACTTCATGTGTTGG + Intergenic
1069155398 10:65023357-65023379 GTCCACCAATGTTCATGTGTTGG - Intergenic
1069155861 10:65030252-65030274 TGTCCCCAAAGTTTATGTGTTGG + Intergenic
1069244878 10:66191797-66191819 TTCTCCCAAAGTTCATGTTTTGG + Intronic
1069297461 10:66864152-66864174 GTTTCCCAAAGATCATGTGTTGG + Intronic
1069412133 10:68164442-68164464 GTCCCCCAATGCTCATGTGCTGG - Intronic
1069632852 10:69907947-69907969 GTCCCCCATAGCTCTTGTGTTGG - Intronic
1070336504 10:75459973-75459995 GTTCCCCAAAGTTCATGTATTGG - Intronic
1071036236 10:81249419-81249441 GTTCTCCAAAGTTCGTGTGTTGG + Intergenic
1071127990 10:82357759-82357781 GTCTCCCAAATTCCATGTGTTGG - Intronic
1071163846 10:82782127-82782149 TATCCCCAAAATTCATGTGTTGG + Intronic
1071177729 10:82945789-82945811 GTTCCTCAAAGTTCCTGTGTTGG - Intronic
1071259136 10:83903770-83903792 ATGCCCCAAAGTGCAATTGTTGG + Intergenic
1071359677 10:84833667-84833689 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1071791301 10:88957046-88957068 GTCTCCCAAAATTCATGTGTTGG - Intronic
1071822741 10:89294601-89294623 GTCCTCCAAAGTTCATGTGTTGG - Intronic
1071857377 10:89639388-89639410 GTCCCCCAGAACTCATGTGTTGG - Intronic
1071958664 10:90786374-90786396 ATTCCCCAAAATACATATGTGGG - Intronic
1071964399 10:90837382-90837404 TTGCCTAAAAGTTCATGTGTTGG + Intronic
1072202299 10:93171432-93171454 GTCCCCCAAAGTTTATGTGTTGG - Intergenic
1072339726 10:94434949-94434971 GTTCCCCAAAATTCATCTGTTGG - Intronic
1072465397 10:95657732-95657754 GTCCCCCAAAATTCATATGTTGG + Intergenic
1072568491 10:96638141-96638163 TGCCCCAAAATTTCATGTGTTGG + Intronic
1072868776 10:99093763-99093785 ATCCTCCAAAATTCATGTGTTGG - Intronic
1073517678 10:104092063-104092085 ATCCCCCAAAGTTCATGTGTTGG + Intergenic
1073586843 10:104718481-104718503 GTCTCCCAAAGCACATGTGTTGG - Intronic
1074098930 10:110338139-110338161 TGTTCCCAAAGTTCATGTGTTGG + Intergenic
1074391578 10:113062574-113062596 ATCCCCAAAAGGTGGTGTGTGGG - Intronic
1074749901 10:116574988-116575010 GTCCCCGAAAGTTTATGTGATGG - Intergenic
1074765218 10:116695263-116695285 GTCCCCGAAAACTCATGTGTTGG + Intronic
1074969694 10:118525981-118526003 TCCCCCAAAAGTTCATGTATTGG + Intergenic
1075210224 10:120484685-120484707 GTCCCCCAAAGTTCATGTGTTGG - Intronic
1075291032 10:121231020-121231042 TGTCCCCAAAGTTCATGGGTTGG - Intergenic
1075350992 10:121725150-121725172 GTCCCCCAAAATTCATGTGTTGG - Intergenic
1075504796 10:123012344-123012366 GTCCCCCAAAATTCATGTGTTGG + Intronic
1075586684 10:123663605-123663627 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1075970483 10:126647989-126648011 GTCCCCCAAAATTCATGTGTTGG + Intronic
1075984366 10:126770872-126770894 GTCGCCCAAAGTACATGTGTTGG + Intergenic
1075989011 10:126817094-126817116 GTCCCCCAAAATTCATGTGTTGG + Intergenic
1075990343 10:126833066-126833088 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
1076104393 10:127809166-127809188 GTCCCCCAAAGGTCATGAGTTGG + Intergenic
1076974075 11:157878-157900 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
1077548937 11:3190877-3190899 TGGCCCCAAAGCTCATGTGTTGG - Intergenic
1077673774 11:4180418-4180440 GTCCCCCAAAGTTCATGTATTGG + Intergenic
1077832105 11:5884565-5884587 ATCCCCCAAAGCTGATCTCTTGG - Exonic
1077834397 11:5911862-5911884 GTCCCTCAAGATTCATGTGTTGG - Intronic
1077876569 11:6313526-6313548 GTCTCCAAAAATTCATGTGTTGG - Intergenic
1077952691 11:6977912-6977934 GTCCCTCAAAGTTCATGTTTTGG - Intronic
1078414287 11:11152669-11152691 GTCCCCCAGAGTTCATGTGTTGG - Intergenic
1078477641 11:11645348-11645370 TTTCCCAAAAGTTCATGTGTTGG - Intergenic
1078678432 11:13449942-13449964 GTCCCCAAAAATCCATGTGTTGG - Intronic
1078732168 11:13984659-13984681 GTCCCCCAAAGTTTATGTGTTGG - Intronic
1078756629 11:14216803-14216825 TTCCCCCAAAATTCATGTGTTGG - Intronic
1078828959 11:14960596-14960618 GTCTCTCAAATTTCATGTGTTGG + Intronic
1078892529 11:15570258-15570280 GTCTTCCAAAATTCATGTGTTGG + Intergenic
1078902682 11:15656013-15656035 TCCCCCAAAAGTTCATGTGTTGG - Intergenic
1079530215 11:21443341-21443363 TCCACCTAAAGTTCATGTGTTGG - Intronic
1079808215 11:24961354-24961376 ATCTCCCATTATTCATGTGTGGG + Intronic
1079982208 11:27163178-27163200 GTCCCCCAAAATTCATGTGTTGG + Intergenic
1080053379 11:27880104-27880126 TCCCACCAAAGTTCATGTGTTGG + Intergenic
1080375540 11:31705410-31705432 GTCCCTCAAATTTCATGTGTTGG - Intronic
1080902953 11:36512921-36512943 GTCCCCTAAATTTCATGCGTTGG + Intronic
1081007799 11:37769116-37769138 ATCCCCAAAAAAACATGTGTTGG - Intergenic
1081394504 11:42569636-42569658 GTTCCCCAAAATTCATGTGTTGG - Intergenic
1081429752 11:42963432-42963454 GTCCTTCAAAGTTCATGTGTTGG - Intergenic
1081752571 11:45522412-45522434 TTCCCCCAAAGTTAACGTGTTGG + Intergenic
1081824811 11:46038901-46038923 GTCCCCCAAGTTTCATGCGTTGG - Intronic
1082776879 11:57252251-57252273 GTCCCGCAAAATTTATGTGTTGG + Intergenic
1082870028 11:57935722-57935744 GTCCCCCAAAAAGCATGTGTTGG - Intergenic
1082931625 11:58613434-58613456 GTTCACCACAGTTCATGTGTTGG - Intronic
1083596884 11:63921902-63921924 TTCCCACAAAGTCCATGTGTTGG + Intergenic
1084502535 11:69543437-69543459 TCCCCCAAAAGTTCATGTGTTGG + Intergenic
1084559825 11:69897478-69897500 GTCCCCTGAAGTTCATGTGCTGG - Intergenic
1084616932 11:70242647-70242669 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1084744789 11:71162459-71162481 GTTCCTCAAATTTCATGTGTTGG - Intronic
1084806713 11:71584382-71584404 GTCCCCCAACATTCATGTGTTGG + Intronic
1084995609 11:72974451-72974473 GTCCTCTAAAGTTCATGTGTTGG - Intronic
1085064513 11:73481785-73481807 GTCTCCCAAAATTTATGTGTTGG + Intronic
1085720882 11:78911535-78911557 GTACCCCAAATGTCATGTGTTGG + Intronic
1085830434 11:79895169-79895191 GTCCTGCAAAGTTCATATGTTGG - Intergenic
1085956595 11:81405346-81405368 ATCCCCCAAAGTTAGCGTGTTGG + Intergenic
1086012906 11:82126625-82126647 GTCCCCCAACACTCATGTGTTGG + Intergenic
1086191372 11:84083459-84083481 TCCCCCAAAAGTTCATGTGTTGG + Intronic
1086420828 11:86635476-86635498 GTCCTCCAAATTTCATGTATTGG + Intronic
1086488416 11:87333602-87333624 GTCTTCCAAAGTTCATGTGTTGG + Intergenic
1086530364 11:87777827-87777849 GTCCTCCAAACTTCATCTGTTGG - Intergenic
1086615941 11:88820048-88820070 GTCCCCCAAAGTTCATGTGTGGG - Intronic
1086670948 11:89546911-89546933 TTCCTCCAAAGTTTGTGTGTTGG - Intergenic
1086854716 11:91852232-91852254 GTCCCCCAAAATTCCTATGTGGG - Intergenic
1086935580 11:92742488-92742510 GTCCGCCAAAGTTTATGTGTTGG + Intronic
1087193722 11:95283808-95283830 GTCCCTCAAAGTTCATGTGTTGG + Intergenic
1087273311 11:96135031-96135053 GCCCCACAAAGTTCATGTGTTGG + Intronic
1087582849 11:100080998-100081020 ATCCCCTTAAGTTCATGGATAGG - Intronic
1087696453 11:101382546-101382568 GTTCCCCAGAATTCATGTGTTGG + Intergenic
1087775527 11:102253315-102253337 GTCCCCCAGAGTTCACGTGTTGG - Intergenic
1087917511 11:103828433-103828455 GTCTCCTAAAGTTCATGTGTTGG + Intergenic
1088181513 11:107118035-107118057 GTTCCCCACAGTTCATGTGTTGG + Intergenic
1088343532 11:108796710-108796732 GTCCTCCAAAGTTATTGTGTTGG + Intronic
1088566429 11:111177687-111177709 ACCCCCCAGATTTCATGTGTTGG - Intergenic
1088635934 11:111820589-111820611 GTCCCCCAAAGTTCATGTATTGG - Intronic
1088709410 11:112493766-112493788 GTCCTCCAAAGTTCCTGTGTTGG - Intergenic
1089007296 11:115102868-115102890 GTCCCCCAAATTTCATGTATTGG - Intergenic
1089107236 11:116023212-116023234 ATTCCCCAAAGTTCATGTGTTGG + Intergenic
1089605027 11:119636730-119636752 GTCCCCCCAAATTCGTGTGTTGG + Intronic
1090148390 11:124354182-124354204 GTTCCCCAAATTTTATGTGTTGG + Intergenic
1090370596 11:126248819-126248841 GTCCCCTAACGTTCATGTGTTGG - Intronic
1090535427 11:127636192-127636214 TCCCTCCAAAATTCATGTGTTGG + Intergenic
1090848721 11:130552058-130552080 GTTCCCCAAAATTCATATGTTGG + Intergenic
1090849323 11:130558170-130558192 ATTCTTCAAAGTTCATGTGCTGG + Intergenic
1090903744 11:131055534-131055556 GTCTCCCAAAATTTATGTGTTGG - Intergenic
1091159007 11:133402387-133402409 CTTCCCCAAAGTTTATGTTTTGG - Intronic
1091197342 11:133743054-133743076 GTCCACTAAAGTTTATGTGTTGG - Intergenic
1091294191 11:134461242-134461264 GTCCCCCAAGGTTCATGTGTCGG + Intergenic
1091744031 12:2979774-2979796 ATCTCCCAACATTCTTGTGTTGG + Intronic
1091812550 12:3411588-3411610 GTCCCCCACATTTCATGTTTCGG + Intronic
1092128873 12:6094558-6094580 GTCCTCCAAAATCCATGTGTTGG + Intronic
1092144044 12:6202410-6202432 AACTCCCAAAGTTCAAGGGTGGG - Intronic
1092440986 12:8502832-8502854 TGCCCCCAAAGTTCACGTATTGG - Intergenic
1092697572 12:11190716-11190738 GTCCCACAAAGTTCACTTGTTGG - Intergenic
1093037817 12:14350005-14350027 GTGTCCCAAACTTCATGTGTTGG + Intergenic
1093193030 12:16096963-16096985 ATCCCCAAAGGTTCATGAGTTGG - Intergenic
1093538825 12:20255989-20256011 ACCTCCCAAAGTTTATGTGTTGG - Intergenic
1093543542 12:20317676-20317698 GTTCTCCAAAATTCATGTGTTGG + Intergenic
1093680237 12:21994000-21994022 GTCCCCCAACATTCATATGTTGG + Intergenic
1093845650 12:23968374-23968396 GTCCCCCAAAGTTCACATGTTGG + Intergenic
1093980790 12:25473027-25473049 GTCCCTCAGAATTCATGTGTTGG - Intronic
1094090262 12:26642279-26642301 GTCCCCCAAAGCTCACATGTTGG + Intronic
1094163670 12:27419578-27419600 GTCCACTAAAATTCATGTGTTGG - Intronic
1094305617 12:29016204-29016226 GTCCCCCACTGTTAATGTGTTGG - Intergenic
1094395757 12:30003632-30003654 TGTCCCCAAAGTTTATGTGTAGG + Intergenic
1094470914 12:30800299-30800321 GTCCCCTAAATTTCATGTCTTGG + Intergenic
1094775525 12:33722771-33722793 AGCCCCCAAATTTCATGTGTTGG - Intergenic
1095136111 12:38605939-38605961 ATCCCCCAAAGTTCATGTGTTGG - Intergenic
1095326154 12:40895676-40895698 GTCCCCCAGATTTCATGTGTTGG - Intronic
1095376497 12:41535562-41535584 GTCCCCCAAAAAGCATGTGTTGG + Intronic
1095522320 12:43082197-43082219 ATTCCCCAAAGTTCATGTATTGG - Intergenic
1095529826 12:43173931-43173953 TCCCCCCAAAGTTCATGTGTTGG + Intergenic
1095648829 12:44582762-44582784 GTCACTCAAAGTTCATATGTTGG + Intronic
1097220689 12:57449133-57449155 GTCCTCCAAAGTTCATGTGCTGG - Intronic
1097411355 12:59256809-59256831 ATCCTCCAAATTTCACATGTTGG - Intergenic
1097443262 12:59637712-59637734 GTTCTCCAAAGTTCATGTGTTGG + Intronic
1097640155 12:62171465-62171487 GTCCCCCGAAATTTATGTGTTGG + Intronic
1097689713 12:62723422-62723444 GTCTCCTAAAATTCATGTGTTGG + Intronic
1097721246 12:63023897-63023919 GTCACCCGCAGTTCATGTGTTGG + Intergenic
1097863323 12:64539400-64539422 GTCCCCCAAATTTCATGTGTTGG - Intergenic
1098012563 12:66070714-66070736 GTCCCCCAAATTTTATATGTCGG + Intergenic
1098016838 12:66114108-66114130 GTCCCTCAGAATTCATGTGTTGG - Intergenic
1098536237 12:71596512-71596534 ATCCTCCAAAGTTTATGTTTTGG + Intergenic
1098607391 12:72408265-72408287 TTCCTCAAAAGTTCATGTGTTGG - Intronic
1098636147 12:72786000-72786022 GTCCCCCAAATTTCATATGTTGG - Intergenic
1098817430 12:75185332-75185354 GCCCCTCAAAGTTCATGTGTTGG + Intronic
1098947221 12:76602178-76602200 TTTCCCCAAAGTTCATGTGTTGG - Intergenic
1099741630 12:86643305-86643327 GTCCCCCAAATTTCATATGTTGG - Intronic
1099810867 12:87580492-87580514 CCTCCCCAAAGTTCATGTGTTGG - Intergenic
1099833691 12:87878883-87878905 GCCCCTCAAAGTTCATGTATTGG - Intergenic
1099873343 12:88374970-88374992 GTCTTCCAAAGTTCACGTGTTGG - Intergenic
1100123759 12:91398404-91398426 ATCCTTCAAAATTCATATGTTGG - Intergenic
1100397433 12:94197235-94197257 ATCCCCCAAAGTTCATGTATTGG + Intronic
1100536089 12:95510612-95510634 ATCCCCCAAAGGTCATGTATTGG - Intronic
1100818659 12:98410317-98410339 ATCTCCCAAATTTCATTTGCTGG + Intergenic
1100957244 12:99922680-99922702 GTCCCCCGAAGTTCATGTGTTGG + Intronic
1101103317 12:101416792-101416814 GTCCTCCAAAGTTCATGTGTTGG + Intergenic
1101219650 12:102624904-102624926 GTCCTCCGAAATTCATGTGTTGG - Intergenic
1101451733 12:104785906-104785928 GTCCCCTAAAGTTCATGTGCTGG - Intergenic
1101467618 12:104963705-104963727 GTCCCCCAAAGCTCATGTGTTGG + Intergenic
1101721112 12:107351479-107351501 ATCCCCCAAGGTTCATGTATTGG + Intronic
1101855175 12:108436246-108436268 ATCCCCCATAGTGCTTGTGCTGG + Intergenic
1102437417 12:112936128-112936150 GTCCCCCAGAATTCATGTGTTGG - Intergenic
1102535700 12:113579132-113579154 GTCTCCCAAAATTCATGTGTTGG + Intergenic
1102892186 12:116568562-116568584 GTCCCCCAAATTTCATGTACTGG + Intergenic
1103093534 12:118114852-118114874 TCCTCCAAAAGTTCATGTGTTGG + Intronic
1103531706 12:121606968-121606990 TCCCCCCAAAATTCATGTGTTGG + Intergenic
1104128981 12:125874452-125874474 ATTCCCCAAAATTCATATATTGG - Intergenic
1104157332 12:126146302-126146324 GGCCCCCAAAGTTTATGTGTTGG - Intergenic
1104486725 12:129157322-129157344 GTCCCCCAGAGTTTATGAGTCGG - Intronic
1104648905 12:130517022-130517044 ATCCCCCAAATTCCATGTGTGGG + Intronic
1104725633 12:131073968-131073990 TCCCCCAAAAGCTCATGTGTTGG - Intronic
1105046171 12:133005566-133005588 ATCTTCCAAATTTCATGTGTTGG + Intronic
1105418791 13:20234877-20234899 GTCCCCTAAAGTCCATGTGTTGG - Intergenic
1105530053 13:21211010-21211032 GTTCCCCAAAGGTCATGTGTTGG - Intergenic
1105808206 13:23971297-23971319 ATCTCTCAAAGTTCATGTGTTGG + Intergenic
1105809112 13:23979206-23979228 ATCTGCTAAAGTTCACGTGTTGG + Intergenic
1105933470 13:25074946-25074968 GTCCCCCACAGTTCATGCGTTGG - Intergenic
1105934171 13:25083374-25083396 ATCCCTCCAAGTTTATGTGTTGG - Intergenic
1105939512 13:25134778-25134800 ATCCCTTAAAGTTGATGTGTTGG - Intergenic
1106580795 13:31016714-31016736 TTCTCCCAAAATTCATATGTTGG - Intergenic
1106738458 13:32612570-32612592 GTTCCCCAAAGTTCATGTGTTGG + Intronic
1106872963 13:34041920-34041942 GTCCCCCAAATTTCATGTGTTGG + Intergenic
1106875636 13:34069461-34069483 GTCCCTCAAAGTTCATGTGCTGG + Intergenic
1106888730 13:34219169-34219191 TCCCCCGAAAGCTCATGTGTTGG - Intergenic
1107019306 13:35735302-35735324 GTTCCCCAAAGTTTATGTGTTGG - Intergenic
1107113189 13:36719895-36719917 GTCCTCCAAATTTCATGTGGTGG + Intergenic
1107252380 13:38379657-38379679 TTCCCCCAAAATTCATGTGTTGG - Intergenic
1107260578 13:38485608-38485630 GTCCCTCAAAATTCATGTGTTGG - Intergenic
1107270594 13:38611196-38611218 GTCCTCCAAAGTTCAGGTGTTGG - Intergenic
1107354432 13:39551468-39551490 TTCTCCAAAAGTTCATGTGTTGG - Intronic
1107523467 13:41206077-41206099 GTCCCCCAAATTTCATGTGTTGG + Intergenic
1107752010 13:43577705-43577727 CTCCTCCAAAATTCATGTGTTGG - Intronic
1107766793 13:43744077-43744099 TCCTCCCAAAGATCATGTGTTGG - Intronic
1107880625 13:44829217-44829239 GTTCCCCAAAGTTCATATGTTGG - Intergenic
1107897216 13:44977026-44977048 TCCCCCAAAAGTTCATTTGTTGG - Intronic
1107974165 13:45673507-45673529 TATCCCCAAAGTTCACGTGTTGG - Intergenic
1108005600 13:45942874-45942896 ACCCCCCAAAGTTCATGTGTTGG + Intergenic
1108125321 13:47236522-47236544 ATCCCACAAAGTTTATGTGTTGG - Intergenic
1108269386 13:48744355-48744377 GCCCCCCAAAGTTCATGTGTTGG + Intergenic
1108516428 13:51207502-51207524 TTTCCCAAAAGTTCACGTGTTGG + Intergenic
1108545730 13:51491207-51491229 GCCCCCCTAAATTCATGTGTTGG - Intergenic
1108582031 13:51836054-51836076 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1108598846 13:51973344-51973366 GTCCCCCAAATTTCATGTGTTGG + Intronic
1108697768 13:52917795-52917817 GTCCCCCAAAAAGCATGTGTTGG - Intergenic
1108805693 13:54152910-54152932 GACCCCTAAAGTTCATGTGTTGG - Intergenic
1108861525 13:54866090-54866112 AGCCCCCAAAGTTCAAGTGTTGG + Intergenic
1109009700 13:56924991-56925013 ATCTCCAAAACTTCATGTATTGG + Intergenic
1109055364 13:57540666-57540688 GTCCCCCAAAGTTCAGGTGTTGG + Intergenic
1109374408 13:61471800-61471822 ATCCCCCAAAGCTCATTCGTTGG + Intergenic
1109588774 13:64447145-64447167 GTCCCTCAAATTTCATGTGTTGG - Intergenic
1109720733 13:66273143-66273165 GTCCCCCAAAGTTTATGGGTTGG + Intergenic
1109869544 13:68315567-68315589 GTTCCCCAAAGTTCATGTATTGG - Intergenic
1109892409 13:68632250-68632272 GTCCCCCAAACTTCAAGTGTTGG - Intergenic
1109988373 13:70019799-70019821 ATGTCCCAAAATTAATGTGTTGG + Intronic
1110076837 13:71256442-71256464 GTCCCCCAAAATTCATGTGTTGG - Intergenic
1110439932 13:75516651-75516673 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1110674138 13:78219891-78219913 TTTCCCCAAAGTTCACGTGTTGG + Intergenic
1110759937 13:79220292-79220314 TTCCCCCTGAATTCATGTGTTGG - Intergenic
1110994173 13:82084335-82084357 GTCTCCCAAAGTTCATTTGTTGG - Intergenic
1111819683 13:93197091-93197113 GTCCCTCAAATTTCATGTGTTGG - Intergenic
1112334464 13:98502457-98502479 GTCCCCCAAAATTCATGGGTTGG + Intronic
1112547864 13:100389238-100389260 CTCCCCCAAACCTCCTGTGTAGG - Intronic
1112615871 13:101004882-101004904 ATCCCCCAAAAAGCATGTGTTGG + Intergenic
1112876980 13:104054334-104054356 ATCCCACAAAGTTGATGTGTTGG + Intergenic
1113196376 13:107811890-107811912 GTCCCCTAAAGTTAATGTGCTGG - Intronic
1113527642 13:110992972-110992994 ATTCCCCAAAGTTCACGTGTTGG + Intergenic
1113778097 13:112960410-112960432 GTCCCCCAAAGGTCGTGTGTGGG - Intronic
1113971386 13:114193647-114193669 ATTCTCCAAAATTTATGTGTTGG - Intergenic
1114391487 14:22313118-22313140 GCCCCCCAAAGTTCATATGTTGG - Intergenic
1114584511 14:23798122-23798144 GTCCCCCAAAATGCATGTGTTGG + Intergenic
1114766235 14:25373866-25373888 GTCCCTCAAAGTTAATGTGTTGG + Intergenic
1114795443 14:25710274-25710296 TTCCCCCAAAGTTTATGTATTGG - Intergenic
1114901681 14:27068201-27068223 ATCCACCAAATTTCATGCATTGG - Intergenic
1115012399 14:28565214-28565236 GTTCCCCATAGTTCATGTGTTGG + Intergenic
1115121208 14:29940446-29940468 GTCCCCCAAATTTCATGTGTTGG - Intronic
1115173299 14:30532946-30532968 TGCCCACAAAGTCCATGTGTTGG + Intergenic
1115326993 14:32150740-32150762 TTCCCCCAAAGTTCTTGTGTGGG - Intronic
1115656025 14:35444524-35444546 GTCCTCCAAATTTTATGTGTTGG - Intergenic
1115891620 14:38036180-38036202 GTCCTCTGAAGTTCATGTGTTGG - Intronic
1116054996 14:39852611-39852633 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1116439700 14:44937993-44938015 TTCCCCAAAAGTTCATATGTTGG - Intronic
1116439998 14:44940294-44940316 TCCCTCCAAAATTCATGTGTTGG - Intronic
1116542825 14:46119717-46119739 GCTCCCTAAAGTTCATGTGTTGG - Intergenic
1116730845 14:48620615-48620637 TTCCCATAAAATTCATGTGTTGG - Intergenic
1116756113 14:48950022-48950044 GTCCCCCAATGTTCATGTTTGGG - Intergenic
1117030488 14:51664021-51664043 TCCCCCAAAAGTTCATGTGTTGG - Intronic
1117143476 14:52812938-52812960 TCCCCCAAAAGTTCATGTGTTGG + Intergenic
1117202491 14:53406609-53406631 AGCCCCCAAAGTTCATGTGTTGG + Intergenic
1117266878 14:54098203-54098225 GTCCCCCCAAATTTATGTGTTGG - Intergenic
1117305811 14:54472053-54472075 GTCCTCCAAAATTCATGTGTTGG + Intergenic
1117435497 14:55712077-55712099 GTCCCCCGAAGTTCATGTGTTGG + Intergenic
1117483407 14:56171151-56171173 GCCCCTCAAAGTTCATGTGTTGG + Intronic
1117514338 14:56485556-56485578 GTCACCCAAAATTCATGTGGTGG - Intergenic
1117668260 14:58079543-58079565 GTCCCCCGAAATTTATGTGTTGG - Intronic
1117833276 14:59776192-59776214 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1117851966 14:59982636-59982658 TCCCCCAAAAGTTCATGTGTTGG - Intronic
1117966158 14:61208936-61208958 GTCCCCTAAAGTTCATAAGTTGG + Intronic
1118033289 14:61839136-61839158 GCCCTCCAAAATTCATGTGTTGG + Intergenic
1118067337 14:62206452-62206474 ATCCCCCAAACTTTATGTGTTGG - Intergenic
1118340282 14:64890049-64890071 GTTCCCCAAAGTTCATGTGTTGG - Intergenic
1118388577 14:65277617-65277639 GTCCCCTAAAGTTCTTGTGTTGG + Intergenic
1118628328 14:67679320-67679342 GTCCCTCAAGGTTCATATGTTGG - Intronic
1118825337 14:69375041-69375063 GTCTCCCAAAGTTTATGTGTTGG - Intergenic
1119503216 14:75148832-75148854 CCCTCTCAAAGTTCATGTGTTGG + Intronic
1119529095 14:75347048-75347070 GTCCCCCAAAGCTCATGTGTTGG + Intergenic
1119533169 14:75377842-75377864 GTCCCCCAGAGTTTATGTGTTGG + Intergenic
1119550256 14:75504799-75504821 GTCCCCCAGAATTCATGTTTTGG - Intergenic
1119560826 14:75588460-75588482 AACAACAAAAGTTCATGTGTTGG - Intronic
1119560876 14:75588781-75588803 GTCCCTTAAAGTTCATGTGTTGG - Intronic
1119919523 14:78433461-78433483 GTCCCCCAAAGTTTATATGTTGG + Intronic
1119990945 14:79196554-79196576 GTCCCCCAGAGTGCATGTGTTGG - Intronic
1120008888 14:79390773-79390795 GTCCCCTAAAGTTCATATATTGG + Intronic
1120321532 14:82968228-82968250 GTCCCCCAAAGCTCATAGGTTGG + Intergenic
1120508989 14:85389673-85389695 GTTCCCCAAAGTTCAGGTGTTGG - Intergenic
1120518701 14:85500933-85500955 GTCTCCTAAAGTTCATATGTTGG + Intergenic
1120841325 14:89087729-89087751 GTCCCTCAAAGTTTCTGTGTTGG + Intergenic
1120887527 14:89463410-89463432 GTCCTCCAAATTTCATGTATTGG - Intronic
1120932363 14:89861598-89861620 GTCCCCCAAATTTCATGTGTTGG + Intronic
1121421098 14:93815026-93815048 ATCCCCCAAAGTTCATGTCTTGG - Intergenic
1121555742 14:94835369-94835391 GTCCCCTAAAGTCCATGTGTTGG + Intergenic
1121831918 14:97060145-97060167 CCCCTCAAAAGTTCATGTGTTGG + Intergenic
1122001727 14:98662763-98662785 TCCCTCCAAAGTTCATGTGTTGG - Intergenic
1122369481 14:101221436-101221458 AGCCCCCATACTTCATGTGGTGG - Intergenic
1122426146 14:101607305-101607327 TTCCCACAAAGTTCATGTGTTGG + Intergenic
1122766986 14:104079430-104079452 ATCCCCCAAAACTCACTTGTTGG - Intergenic
1122833475 14:104417598-104417620 ATCCCCCAAAATTCATATGTTGG + Intergenic
1122866901 14:104610295-104610317 GTCCCCCAAAATTCATATGTTGG + Intergenic
1122929211 14:104925782-104925804 ATCCCCCAGAGTTCAGCTCTGGG + Intronic
1124032005 15:26020265-26020287 GTCCCCCAGAGGTCCTGTGTTGG - Intergenic
1124347649 15:28933211-28933233 CCCCCCCAAAGTTCATGTGTTGG - Intronic
1124363033 15:29053017-29053039 GTCCCCCAAAGTTCATGCGTTGG - Intronic
1124381483 15:29171192-29171214 TCCCCCAAAAGTTCATATGTTGG - Intronic
1124508876 15:30305396-30305418 GTACCCCAAAGTTCATGTGTTGG - Intergenic
1124591359 15:31056579-31056601 GTCCCCCAAAGTTCTTGTGTTGG + Intronic
1124618952 15:31263232-31263254 ATCCCCCCAAGTTTATGTCTCGG - Intergenic
1124643494 15:31416877-31416899 GTCCCTCAAAGTTCATGTGTTGG + Intronic
1124698745 15:31892453-31892475 TCCCTCCAAAATTCATGTGTTGG - Intergenic
1124717837 15:32083111-32083133 GTCCCCCAAAGTTCATATGTTGG + Intronic
1124734682 15:32233266-32233288 GTACCCCAAAGTTCATGTGTTGG + Intergenic
1125255050 15:37753580-37753602 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1125402165 15:39315835-39315857 ATCCCCTAAAGACCATATGTTGG - Intergenic
1125753656 15:42047556-42047578 GCCCCCCAAAGGTCATGTGTTGG - Intronic
1125753902 15:42049446-42049468 GTCCCCCAGCATTCATGTGTTGG - Intronic
1125814041 15:42568526-42568548 GTCCCCCAAAGTTCAAGTGTTGG - Exonic
1126221389 15:46218240-46218262 GTCCCCTAAAGTTCATGTGATGG - Intergenic
1126283186 15:46980409-46980431 GTCTCCCAAAGTTCTTGTGTTGG + Intergenic
1126423542 15:48501161-48501183 GTCCTCCAAAGTTCATGTGCTGG + Intronic
1126656330 15:50981652-50981674 GTACTCCAAAGTTCATGTGTTGG + Intronic
1126769017 15:52036623-52036645 GTCCCCCAAAGTTCATGGGTTGG - Intronic
1126846361 15:52764335-52764357 GTCCCCCAAATTTCATGTGTTGG - Intronic
1126853343 15:52812799-52812821 GTTCCCTAAATTTCATGTGTTGG + Intergenic
1127143537 15:56001811-56001833 GTCTCCCAAAGTTTATGTGTTGG + Intergenic
1127518911 15:59723837-59723859 GTCCCCTCAAATTCATGTGTTGG + Intergenic
1128230956 15:66034741-66034763 TTCCCCAAAAGTTTATGTGTTGG + Intronic
1128303761 15:66584252-66584274 GTCCCCCAAAGTTTGTGTGTTGG + Intronic
1128359235 15:66949154-66949176 GTCTCCCAAATTTCACGTGTTGG + Intergenic
1128564086 15:68687965-68687987 GTTCCCCAGAGTTCATGTGTTGG - Intronic
1129786011 15:78310611-78310633 GTCCCCCAAAGTTCGTGTGTTGG - Intergenic
1130017058 15:80195754-80195776 GTCCCCCAAAGTTCATATGTTGG - Intergenic
1130052208 15:80493306-80493328 GTCCTCCAAAGCTCATGTATTGG - Intronic
1130818028 15:87461323-87461345 GTCCCTCAAATTTCATGTGTTGG + Intergenic
1130846961 15:87756545-87756567 GTCCCTCAAAGTTTATGTGTTGG - Intergenic
1130847217 15:87758648-87758670 GTCCCTCAAAGTTTGTGTGTTGG - Intergenic
1131319622 15:91374704-91374726 ATCCCCAAAAGTTCAAGAGTTGG - Intergenic
1131518869 15:93098547-93098569 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1131662912 15:94537896-94537918 CTCCCCCAAAGTTCATGTGGTGG + Intergenic
1131724787 15:95209359-95209381 GTCTCCCAAAATTCTTGTGTTGG - Intergenic
1131769629 15:95721835-95721857 CTGCCCCAAAGTTCATGTGTTGG - Intergenic
1131861994 15:96663654-96663676 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1132910240 16:2306555-2306577 GGCCCCCCAAATTCATGTGTTGG + Intronic
1133003485 16:2863850-2863872 TGTCCCCAAAGTTCATGTGTTGG + Intergenic
1133827373 16:9290427-9290449 GTCTCTCAAAATTCATGTGTTGG - Intergenic
1133852189 16:9515959-9515981 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1134038522 16:11050311-11050333 GTCCCCCATAGTTCATGTGTTGG - Intronic
1134305101 16:13024788-13024810 GACCCTCAAAGTTCCTGTGTTGG + Intronic
1134730492 16:16457831-16457853 GTTCCCCAAAGTTCAAGTGCTGG - Intergenic
1134936941 16:18254065-18254087 GTTCCCCAAAGTTCAAGTGCTGG + Intergenic
1135072914 16:19368050-19368072 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1135419529 16:22296552-22296574 GTCCCCCAAATTTCATGTGTTGG - Intergenic
1135606424 16:23828946-23828968 CCCCCCCAGATTTCATGTGTTGG - Intergenic
1135650648 16:24203517-24203539 TTCTCCCAAAGTTCTTGTGCTGG - Intronic
1135754292 16:25083647-25083669 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
1136089571 16:27908780-27908802 CTCTCCAAAAATTCATGTGTTGG - Intronic
1136612456 16:31374821-31374843 ATCACCCAATGTTCGTGTGTTGG + Intronic
1136623858 16:31449381-31449403 GTCCCCTAAAGTTCATGTGTTGG - Intergenic
1136627254 16:31469383-31469405 GTACCCCAGAGTTCATGTGTTGG + Intergenic
1136720432 16:32315627-32315649 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
1136725486 16:32354018-32354040 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1136838809 16:33521901-33521923 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
1136843815 16:33560074-33560096 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1137309352 16:47238896-47238918 ATCCCCCCAAATTCATGTCTTGG + Intronic
1137572146 16:49573700-49573722 GTCCCCCAAATTTCATGTGTTGG - Intronic
1137856747 16:51802282-51802304 GTCCCCAAAAGTTCATGTGTTGG - Intergenic
1137898577 16:52239961-52239983 GTCCCTCAAAGTTTATGTGTTGG + Intergenic
1137909122 16:52358129-52358151 GTCCCCAAAAGTTCATGTGTCGG - Intergenic
1137989858 16:53143157-53143179 GTCCCCCAAAGTTTAGGTGTTGG - Intronic
1138208554 16:55143579-55143601 GTCCCCCAGAGTTCATGTGCTGG + Intergenic
1138484128 16:57325226-57325248 GTCCCCCAAAGTTCATGTCTTGG - Intergenic
1138621734 16:58216874-58216896 GTCCCCCAAAGACCTTGTGTTGG + Intergenic
1138638919 16:58367189-58367211 GTCCTACAAAGTTCATGTCTTGG - Intronic
1138641231 16:58388940-58388962 ATCCCCCAAAATTCATGCATTGG - Intronic
1138693281 16:58788609-58788631 TTCCTCCAAAATTCATATGTTGG - Intergenic
1138976618 16:62215145-62215167 GTCCCCCATTGTTTATGTGTTGG + Intergenic
1139093439 16:63676654-63676676 GTCCCCCAAAATTCAAATGTTGG - Intergenic
1139381323 16:66533643-66533665 ATCCCCTAAATTTCATGTGTTGG + Intronic
1139401850 16:66688261-66688283 TTCCCCCAAAATTCAGATGTTGG - Intronic
1140066835 16:71618579-71618601 GTTCCCCAAAATTCATATGTTGG + Intergenic
1140391713 16:74592845-74592867 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1140554619 16:75907727-75907749 GTTCCCCAAAGTTCGCGTGTTGG + Intergenic
1140584115 16:76268402-76268424 GTCCCCCAAAGTTCGTATGTTGG + Intergenic
1141150963 16:81564491-81564513 ATCCCCTAGAGTTGATGTGGGGG + Intronic
1142446183 16:90139785-90139807 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
1203000946 16_KI270728v1_random:163738-163760 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1203006000 16_KI270728v1_random:202142-202164 GTTCCCCAAAGTTCATGTGTTGG - Intergenic
1203132547 16_KI270728v1_random:1700141-1700163 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1203148974 16_KI270728v1_random:1822189-1822211 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
1203153980 16_KI270728v1_random:1860372-1860394 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1142461322 17:95678-95700 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
1142541744 17:665036-665058 CATCCCCAAAGTTCATGTGTTGG + Intronic
1143316926 17:6039885-6039907 GTCCCCCAAAATCTATGTGTTGG - Intronic
1143371002 17:6439415-6439437 GTCCCCCAAATTTCATCTGTTGG - Intergenic
1143942996 17:10562358-10562380 GTCCTCCAAAGTTCATGTATTGG + Intergenic
1144244023 17:13345511-13345533 GTCTCCCAAAATTAATGTGTTGG - Intergenic
1144244036 17:13345604-13345626 GTCTCCCAAAATTCATGTGTTGG - Intergenic
1144598340 17:16590248-16590270 GTCCTCCAATGTCCATGTGTTGG + Intergenic
1144647458 17:16985138-16985160 GTCCCCCAAAATTCATGTGTTGG + Intergenic
1144749481 17:17638557-17638579 GTCTCCTAAATTTCATGTGTGGG + Intergenic
1144939416 17:18927289-18927311 TCCCTCCAAAATTCATGTGTTGG - Intronic
1145030066 17:19498179-19498201 GTCCTCCAAATTTCATGTGTTGG + Intronic
1145102512 17:20088768-20088790 ACCCCCCAAAATTTATCTGTTGG + Intronic
1145727420 17:27144023-27144045 CCCCCCCAAATTTCATGTGTTGG + Intergenic
1146098151 17:29952332-29952354 TTCCTCCAAAATTCATATGTTGG - Intronic
1146529977 17:33600191-33600213 GTCCCCCAAAGTTGATGTGTTGG + Intronic
1146530224 17:33602257-33602279 GTCCCCCAAAGTTCCTGTGCTGG + Intronic
1146597317 17:34181495-34181517 ATCACCCAAAGTTTATGTTAGGG - Intergenic
1146666075 17:34704660-34704682 CTCTTCCAAAATTCATGTGTTGG + Intergenic
1146730151 17:35186233-35186255 TGTCCCCAGAGTTCATGTGTTGG - Intronic
1147512404 17:41082187-41082209 GTCCCTCAAAGTTCATGTGTTGG + Intergenic
1147514573 17:41103364-41103386 GTCCCTCAAAGTTCATGTGTTGG + Intronic
1147584346 17:41645154-41645176 ATCCCCCAAAGTTCATGTTTTGG + Intergenic
1147985601 17:44305882-44305904 GTCCCCCGAAGTTCATGTGTTGG - Intergenic
1148042334 17:44718109-44718131 ATCCCCCAATGTTCTTGTCCTGG + Intronic
1148604336 17:48917471-48917493 ATCCCCTAAAGTTGCTCTGTAGG + Intronic
1148634445 17:49137224-49137246 GCCCCTCAGAGTTCATGTGTTGG + Intronic
1148664443 17:49363704-49363726 GTCCCCCAAAGTTCACATGTTGG + Intergenic
1148934934 17:51157530-51157552 GTCCCCCAAAGTTCGTATGTTGG - Intronic
1149079773 17:52641109-52641131 GTCCCCCAAAGTTCATGTCATGG - Intergenic
1149194963 17:54108528-54108550 GTACCCCAAAATTCATGGGTTGG - Intergenic
1149324740 17:55518385-55518407 GTTCCCCAAAGTTCGTGTATCGG - Intergenic
1149965945 17:61164292-61164314 TGTCCCCAAAGTTCATGTGTTGG + Intronic
1150686870 17:67327961-67327983 CCCCCCCAAAGTTCATGTGTTGG + Intergenic
1150967204 17:69984813-69984835 ATCCCCCAAAGTTTTTGTATTGG - Intergenic
1150998578 17:70347727-70347749 GTTCCCCAAAACTCATGTGTTGG - Intergenic
1151082522 17:71345112-71345134 GTCCCCCAAAGTTTATATGTTGG + Intergenic
1151082800 17:71347536-71347558 ATCCCACAAAGTTCATGTGTTGG + Intergenic
1151435282 17:74091817-74091839 ATCCCCCAAAATTCATGTATTGG - Intergenic
1151835391 17:76579566-76579588 GTCCCCCAAAGTTTATGTGTTGG + Intronic
1151949993 17:77346779-77346801 GTCCCCCAAAATTCATATGTTGG + Intronic
1152010694 17:77712071-77712093 TGTCCCCAAATTTCATGTGTTGG + Intergenic
1153038265 18:785582-785604 TGCACCCAAAGTTCACGTGTTGG + Intronic
1153181106 18:2434804-2434826 GTCCCCCAAAATTCATTTATTGG + Intergenic
1153240038 18:3022716-3022738 ATTCCCCAAACTTCATGTGTCGG - Intergenic
1153462714 18:5354117-5354139 ATCTTCCAAAGAGCATGTGTTGG - Intergenic
1153581444 18:6577935-6577957 GTCCCCTATATTTCATGTGTAGG - Intronic
1153677320 18:7467380-7467402 GTCTCTCAAAGCTCATGTGTTGG + Intergenic
1153715547 18:7844110-7844132 ACCCCACCAAGTTCATGTGAAGG + Intronic
1154064938 18:11098545-11098567 ATTCCTCAAAGTTCAAGTGTTGG + Intronic
1155541934 18:26877959-26877981 GTCCCCCCAAATTCATGTGCTGG + Intergenic
1155592772 18:27446666-27446688 GTCTCCCAAACTTCATGTGATGG - Intergenic
1155694806 18:28672491-28672513 TTCCTCCAAAATTCATGTGTCGG - Intergenic
1155733719 18:29194764-29194786 TTCATCCAAAGTTCATATGTAGG - Intergenic
1155759555 18:29548936-29548958 ATACCCCAAAAAGCATGTGTTGG + Intergenic
1156148299 18:34213179-34213201 GTTCCCCGAAGTTCCTGTGTTGG + Intronic
1156209565 18:34924682-34924704 GTCCCTGAAAGTTCATGTGTTGG - Intergenic
1156386336 18:36608488-36608510 CCCACCCAAAGTTCATGTGTTGG - Intronic
1157023345 18:43813470-43813492 TTCCCCAAAAATTTATGTGTTGG - Intergenic
1157820739 18:50766657-50766679 TGCCTCCAAAATTCATGTGTTGG + Intergenic
1157889849 18:51405274-51405296 TGCCCCCAAAATTCATTTGTTGG + Intergenic
1158034196 18:53004866-53004888 ACTCTCCAAAGTTCATATGTTGG + Intronic
1158063559 18:53377552-53377574 GTCCCTCAAGGTTCATGCGTTGG - Intronic
1158089093 18:53689706-53689728 GTCCTCCAAAGTTCATGTGCTGG - Intergenic
1158125136 18:54092545-54092567 TCCCGCAAAAGTTCATGTGTTGG + Intergenic
1158490934 18:57909267-57909289 GTCCCCCTAAATTCATGTGTTGG + Intergenic
1158618628 18:59010806-59010828 CTCCCCCAAAATTCATGTGTTGG - Intergenic
1158992037 18:62879109-62879131 GTCCTCCAAAGTTGATGTGTTGG + Intronic
1159098059 18:63927672-63927694 TTCCTCCAAAATTCATATGTTGG - Intronic
1159127272 18:64238131-64238153 GTCCCCAAAAATTCATGTGTTGG + Intergenic
1159270290 18:66140384-66140406 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1159507647 18:69357315-69357337 ATCCCAGAAAGCTCAGGTGTGGG - Intergenic
1159942784 18:74421318-74421340 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1160037334 18:75314162-75314184 GTCTTCCAAAGTTCATGTGTTGG + Intergenic
1160103078 18:75942075-75942097 GTCTCCCAAAAATCATGTGTTGG - Intergenic
1160421420 18:78749502-78749524 TTCCCCAGAAGTTCATGTGTTGG + Intergenic
1160547571 18:79670554-79670576 GTCCCACAAAGTTCATGTGTTGG - Intergenic
1160651023 19:228045-228067 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
1161014007 19:1974471-1974493 ACCCCCCAAGGGTCATGTGTTGG - Intronic
1161599087 19:5169841-5169863 GTCCCCCCAAAGTCATGTGTTGG - Intronic
1162148019 19:8625244-8625266 GTGCCCCAAAATTCATGTGTTGG - Intergenic
1162306398 19:9876837-9876859 TCCCCGCAAAATTCATGTGTTGG + Intronic
1163052796 19:14697091-14697113 GTCCTCCACAGTTCATGGGTTGG - Intronic
1163146522 19:15383059-15383081 TTCCCCCAAAATTCATTTGGTGG + Intronic
1164500369 19:28814585-28814607 TCCTCCCAAAGTTCATGTGCTGG - Intergenic
1164889841 19:31814035-31814057 GTCTCCCAAAGTTCTTGGGTTGG + Intergenic
1165184810 19:34008675-34008697 GTCCCCCAAAGTTCACATGTTGG - Intergenic
1165521379 19:36316881-36316903 GTTCCCCAAAGTTCATGTGTTGG - Intergenic
1165622682 19:37261708-37261730 GTTCCCCGAAGTTCATGTGTTGG + Intergenic
1165634386 19:37328342-37328364 GTTCCCCAAAGTTCATGTGTTGG + Intronic
1165730144 19:38140015-38140037 TTCCCCCAAAAGTCACGTGTTGG - Intronic
1165994617 19:39834936-39834958 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1165997287 19:39853205-39853227 GTCCCTCAAAATTCATGTGTTGG - Intergenic
1166031895 19:40137534-40137556 GTCCCCCACAATTCGTGTGTTGG - Intergenic
1166051159 19:40261114-40261136 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1166115753 19:40653129-40653151 AACCCACAAAGTTCATGGGGAGG + Intergenic
1167070380 19:47218634-47218656 GTCCCCCAAAGTTCTTGGGTTGG - Intergenic
1167651495 19:50732317-50732339 AGCCCCCAAAATTCATATTTTGG - Intergenic
924986317 2:273278-273300 GTCCCCCAAAGTTCCTTTGTTGG - Intronic
925258709 2:2511487-2511509 GTTCCCCAAAGTTGATGTGTTGG + Intergenic
925433471 2:3816796-3816818 AATCCCCAAACTTGATGTGTAGG + Intronic
925516457 2:4689046-4689068 GTCCTCCAAAATTCATATGTTGG - Intergenic
925568889 2:5287951-5287973 GTCAGCCACAGTTCATGTGTGGG - Intergenic
925810283 2:7693577-7693599 ATCCCCCACAGTGCAAGGGTTGG - Intergenic
926283784 2:11471443-11471465 GCCCCCCAGAATTCATGTGTTGG - Intergenic
926402340 2:12510701-12510723 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
926442330 2:12902842-12902864 GGCCTCCAAATTTCATGTGTTGG - Intergenic
926798340 2:16637268-16637290 ATCCCCCTAAATTCATAGGTTGG + Intronic
926922605 2:17954037-17954059 GTCCCCCCAGTTTCATGTGTTGG + Intronic
927196828 2:20553581-20553603 GCTTCCCAAAGTTCATGTGTTGG - Intergenic
927599689 2:24430196-24430218 GTCCCCCGAAATTCATATGTTGG + Intergenic
927758294 2:25726267-25726289 GTGCCCCCAAATTCATGTGTTGG - Intergenic
927828576 2:26327965-26327987 GTCCCCCAAAGTTCATGTGTTGG - Intronic
928110859 2:28507571-28507593 GTCCCCCAAAATTCATATGTTGG - Intronic
928581552 2:32712917-32712939 ATCTCCCAAAGTTGATGTGGTGG + Intronic
928790174 2:34940590-34940612 TCTCCCAAAAGTTCATGTGTTGG - Intergenic
928844925 2:35659781-35659803 ATCCTCCAAAATTCATGTGTTGG - Intergenic
928929287 2:36607359-36607381 GTCCCCTAAAGTTTATGTGTTGG - Intronic
928951681 2:36818823-36818845 ATCCCCCAAAGTTTATGCAATGG - Intergenic
929172334 2:38944514-38944536 GTCCCCCAAAATTCATGTGCTGG - Intronic
929214134 2:39392628-39392650 GTCCCTCAAAGCTTATGTGTTGG + Intronic
929493816 2:42422156-42422178 GTCCCCCAAAGTTTATGTGTTGG + Intronic
929754502 2:44752857-44752879 TTTCCCCCAAATTCATGTGTTGG - Intronic
930138997 2:47932592-47932614 ATTCCTCAAAGTTCATTTGCAGG + Intergenic
930259322 2:49126504-49126526 GTCCCCCAAAGTTTATGTGTTGG - Intronic
930483329 2:51978075-51978097 GTCCTCCAAAGTTCATGTGTTGG + Intergenic
930674689 2:54187793-54187815 GTCCTCCAGAATTCATGTGTTGG + Intronic
930869678 2:56157550-56157572 ATGACCCAAAGTTCTTGTGTAGG + Intergenic
930876351 2:56222123-56222145 GTCCCCCATAGTTCATGTGTTGG - Intronic
931290520 2:60869184-60869206 GTCCCTCAACATTCATGTGTTGG - Intergenic
931381078 2:61753926-61753948 GTCCCCCAAAGTTCATGTGCTGG - Intergenic
931496359 2:62811906-62811928 ATCCCCCAAAGTTCTTGTGTTGG + Intronic
931496628 2:62814101-62814123 GTCCCCCAAAGTTCCTGTGTTGG + Intronic
931620807 2:64207530-64207552 GTCCCATAAAGTTCATGTGTTGG - Intergenic
931861531 2:66359840-66359862 TCTCCCCAGAGTTCATGTGTTGG + Intergenic
932002958 2:67901302-67901324 GTCCCCCAAAGTTCACATGTTGG + Intergenic
932061367 2:68502218-68502240 GTCCCCCAAAGTCCATGTGTTGG - Intronic
932224433 2:70028566-70028588 ATCCACCAAAGTTCATGTGTTGG + Intergenic
932272498 2:70423106-70423128 GTCCCCCAAAATTCATTTGTTGG - Intergenic
932562212 2:72883084-72883106 GTGCCCCAAAGTTCATGTGTTGG - Intergenic
932683583 2:73848755-73848777 GTCTCCCAAAGTTCATGTTTTGG - Intronic
932695554 2:73953215-73953237 TCCCCCCAGAATTCATGTGTTGG - Intronic
932790398 2:74649851-74649873 GTCCCCCAAAGTTCATTTGCTGG - Intergenic
933223773 2:79721501-79721523 GTCCCCCACATTTCATGTGTTGG - Intronic
933525089 2:83427475-83427497 GTCCCTCAAAGTTTATGTATTGG - Intergenic
933598051 2:84302499-84302521 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
933618789 2:84512532-84512554 GTCCCCTGAAGTTCATATGTTGG - Intergenic
933732363 2:85466991-85467013 GTCCCCCAAAGTTCATGTACTGG - Intergenic
933757952 2:85655098-85655120 GTCCCCCAAATTTCATGTCTTGG + Intergenic
933795273 2:85914564-85914586 GTTCTCCAAAGTTCATATGTTGG - Intergenic
933946803 2:87293856-87293878 GTTCCCCAAAGTTCATGCATTGG - Intergenic
934320399 2:91966546-91966568 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
934546831 2:95224723-95224745 GTCCCCTAAAGTTCATGTGTTGG + Intronic
934602888 2:95671687-95671709 ATCCCCTATAGTTCCTTTGTAGG - Intergenic
934604648 2:95684838-95684860 GTCCCCCAGAGTTCAAATGTTGG - Intergenic
934912421 2:98271872-98271894 GTCCCCCAGAGTTCATGTGTTGG + Intronic
935051205 2:99526423-99526445 GTCCCCTAGAGTTCATGTGTTGG - Intergenic
935517321 2:104056820-104056842 ATCCCCCAAAGTTCATATGTTGG - Intergenic
935559960 2:104549485-104549507 GTCCCCCAAAGTTCTTATGTTGG - Intergenic
935560141 2:104550905-104550927 GTCCCCTAAAGTTCATGTGTTGG - Intergenic
935667063 2:105522004-105522026 GTCCCCTAAATTTTATGTGTTGG - Intergenic
935823911 2:106922802-106922824 GTCCCCCAGAATTCATGTGTTGG + Intergenic
936001564 2:108836103-108836125 ATTCCTCAAAATTTATGTGTTGG - Intronic
936026840 2:109037822-109037844 ATCCAACCAAGTTCATGAGTTGG + Intergenic
936045241 2:109182437-109182459 GTCCCCCAAAGTTTATGTGTTGG - Intronic
936254308 2:110897641-110897663 TACCCCCAAAATTCATGTGTTGG - Intronic
936341275 2:111634515-111634537 GTCCCCCAAAAGTGATGTGTTGG - Intergenic
936405579 2:112199677-112199699 GCCCCCAAATGTTCATGTGTTGG + Intergenic
936412097 2:112268990-112269012 GTCCCCCAAAATTCATGTGTTGG - Intergenic
936438980 2:112533792-112533814 GTTCCCCAAAGTAAATGTGTTGG - Exonic
936536268 2:113313881-113313903 ATCCCCTATAGTTCCTTTGTAGG - Intergenic
936538099 2:113327365-113327387 GTCCCCCAGAGTTCAAATGTTGG - Intergenic
936752224 2:115658947-115658969 GTCCCCCAAAGTTTATGTGTTGG + Intronic
936756768 2:115723217-115723239 AACCTCCAATGTTTATGTGTCGG + Intronic
937371984 2:121304843-121304865 TTCCCGCCAAATTCATGTGTTGG + Intergenic
937564622 2:123269096-123269118 AATCCCCAAAACTCATGTGTTGG - Intergenic
937649357 2:124302697-124302719 ATCTCCCAAAGTTCACATGTTGG - Intronic
937935741 2:127242474-127242496 GTCCCCCAAATTTTATGTGTTGG - Intergenic
937951720 2:127393192-127393214 GTCCCCCAAAGGTCATGTTTTGG - Intergenic
937976889 2:127588003-127588025 GTCCCCTAAAATTCATATGTTGG - Intronic
938060056 2:128246736-128246758 ACCCCTCAAAGGTCATGTGTTGG - Intronic
938089270 2:128420482-128420504 ATTCCCCACAGTTCATGTGCTGG + Intergenic
938736506 2:134191274-134191296 GTCCTCCAAAGTTCATGTGTTGG + Intronic
939146408 2:138420475-138420497 TTCCTCCAAAGTTCATGTATTGG + Intergenic
939260823 2:139806721-139806743 ATCCCTCAAATTTCTTGTGTTGG + Intergenic
939468864 2:142593830-142593852 ATCCCCCAAAATTCATGTGTTGG + Intergenic
940298898 2:152158940-152158962 ATCCCCCAAAATTTACGAGTTGG - Intronic
940487674 2:154316828-154316850 GTCACCCAAATTTCATGTGTTGG - Intronic
940506086 2:154554885-154554907 GCACCCCAAATTTCATGTGTGGG - Intergenic
940547697 2:155110095-155110117 TCCCCCTAAAGTTCACGTGTTGG + Intergenic
940636893 2:156308491-156308513 CTCCCCAAAAGTCTATGTGTCGG - Intergenic
940890217 2:159028074-159028096 GTCCCCCAACTTTCATGTGTTGG - Intronic
941006308 2:160250823-160250845 GTTCTCCAAAGTTCTTGTGTTGG + Intronic
941685923 2:168448703-168448725 GTCCCCAAAAGTTTGTGTGTTGG + Intergenic
942173792 2:173311774-173311796 GTTCTCCAAAGTTCATGTGTTGG - Intergenic
942198977 2:173552033-173552055 CTCCTCCAGATTTCATGTGTTGG - Intergenic
942259981 2:174150082-174150104 TTCCGCGAAAGTTCATGTGTTGG + Intronic
942483164 2:176411281-176411303 GTCTCCCAAAGTTCATGTGTTGG - Intergenic
942527268 2:176867676-176867698 GTCGCCCAAATTTCATGTGTTGG + Intergenic
942550134 2:177107252-177107274 GTCCCCCAAAGTTCACGTGTTGG + Intergenic
942745379 2:179225886-179225908 GTCCCCCAAAATTCATGTGTTGG - Intronic
942917692 2:181331412-181331434 GCCCCACAAAGTTCATGTGTTGG - Intergenic
943024906 2:182615975-182615997 GACCTCCAAAGTTAATGTGTTGG - Intergenic
943050996 2:182913274-182913296 TCCCCGAAAAGTTCATGTGTTGG + Intronic
943107341 2:183561696-183561718 TTCCCCCAAATCTCATGTGTTGG - Intergenic
943129182 2:183836438-183836460 GTTCCCTAAAGTTCGTGTGTTGG - Intergenic
943330184 2:186549632-186549654 GTCCCCCAAAGTTTATGTGTTGG - Intergenic
943395281 2:187325803-187325825 TTCCCCCAGGGTTCATGTGCTGG + Intergenic
943618077 2:190116495-190116517 ATCCCCCAAAAGGCATGTGTTGG - Intronic
943635808 2:190305610-190305632 GTCCCCCAAAATTCATATGTTGG - Intronic
943823067 2:192352105-192352127 GTCCCCCAAATTTCATATGTTGG - Intergenic
943844681 2:192630138-192630160 GTCCCCAAAAGTTCATGTGTTGG + Intergenic
944429013 2:199613366-199613388 TTCCCCAAAAGTATATGTGTTGG - Intergenic
944430653 2:199630045-199630067 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
944500731 2:200357014-200357036 ATCCCTTAAAGTTCATGTGTTGG - Intronic
945390068 2:209254701-209254723 GTCCCCCAAAATTCATGTGTTGG + Intergenic
945403166 2:209413250-209413272 GGCCCCTTAAGTTCATGTGTTGG + Intergenic
945877010 2:215288611-215288633 ATACCCCAAAGTTCACACGTTGG + Intergenic
945964646 2:216173620-216173642 GTCACCCAAAGTTTATGTGTTGG + Intronic
945991350 2:216397988-216398010 GTCCCCCAAAGTTGGTGTTTTGG + Intergenic
946296455 2:218787538-218787560 GTTTCCTAAAGTTCATGTGTTGG + Intronic
946500356 2:220240709-220240731 GTCCCCCAAAGTACATGTGTTGG - Intergenic
946533285 2:220597432-220597454 GTCTCTCAAAGTTCATGTGTTGG + Intergenic
946582788 2:221148598-221148620 ATCTCCCAAAGTTAATGTGTTGG + Intergenic
946961054 2:224986456-224986478 TCCCCCCAAAATTCATATGTTGG + Intronic
946967893 2:225057625-225057647 GTTCCCCAGAGTCCATGTGTTGG + Intergenic
946983091 2:225240134-225240156 ACCCCACACAGTTAATGTGTGGG + Intergenic
947036450 2:225863649-225863671 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
947404455 2:229760469-229760491 TCCTCCAAAAGTTCATGTGTTGG + Intergenic
947487401 2:230564832-230564854 GTCCACCAAAGTTCACGTGTTGG + Intergenic
947540628 2:230975091-230975113 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
947866988 2:233405158-233405180 GTCCTCCAAAGTTCATGTGTTGG + Intronic
947951251 2:234149341-234149363 ATCCCTCAAATTTCATGTGTTGG + Intergenic
947966356 2:234284911-234284933 GTCCCCCAAAGTTCGTGTGTTGG + Intergenic
948378091 2:237535385-237535407 GTCCCCTAAAGTTCATGTGTTGG - Intronic
948554740 2:238800465-238800487 TCCCCCCAAAATTCTTGTGTTGG - Intergenic
948995847 2:241578026-241578048 TTCCCCAAAAGTTCATGTGTTGG + Intergenic
1168765136 20:377021-377043 GTCCCCCAAATGTCATGTGCTGG - Intronic
1168957389 20:1843888-1843910 GTCCCCTAAAGCTCATGTGTTGG + Intergenic
1168961449 20:1872785-1872807 ATCCCCCAGAGTTCACATATTGG + Intergenic
1169286961 20:4317039-4317061 TCCCCCCAAAACTCATGTGTTGG - Intergenic
1169431389 20:5539383-5539405 ATTCCCCAATGTCCATGTGTTGG - Intergenic
1169616885 20:7457828-7457850 ACCTCCAAAAGTTCATGTTTTGG + Intergenic
1169890286 20:10444864-10444886 ATCCCCCCAAATTTATATGTTGG - Intronic
1169982501 20:11401891-11401913 ATCTTTCAAGGTTCATGTGTTGG + Intergenic
1170027457 20:11905584-11905606 ATCCCCCATCATTCAGGTGTGGG + Intronic
1170104538 20:12739085-12739107 TTCCCCCAAAGTTCATGTGTTGG - Intergenic
1170497244 20:16937762-16937784 GTCTCCCAAATTTCATGTGTTGG - Intergenic
1170715464 20:18827460-18827482 GTCCCTCAAATTTCATGTGTTGG + Intronic
1170742054 20:19066787-19066809 TTCCCCCCAAATTCATGTGTTGG + Intergenic
1170794654 20:19536070-19536092 TTCCCCCAAAGTTCATGCGTTGG - Intronic
1170817202 20:19723873-19723895 AACCCCCACAGTTCCTGGGTTGG - Intergenic
1171203873 20:23264440-23264462 TTCCCCCGAAGTTCATATGTTGG - Intergenic
1171399797 20:24865446-24865468 GTTCCCCAAACTTCAGGTGTTGG - Intergenic
1172324194 20:34021619-34021641 GTCTCCTAAAGCTCATGTGTTGG - Intronic
1172500819 20:35425858-35425880 TCCTCCAAAAGTTCATGTGTTGG + Intergenic
1173270266 20:41527750-41527772 GTCCCCCAAAATTCCTGTGTTGG + Intronic
1173292716 20:41728589-41728611 GTCCTCCAAAGTTTATGTTTTGG + Intergenic
1173495699 20:43515669-43515691 AGCACCCAAAGTACATGTGCAGG + Intronic
1173601955 20:44301714-44301736 ATTTTCCAAAGTTCATGTCTTGG - Intergenic
1174197208 20:48781884-48781906 GTCCCCCAAGGTTCAATTGTTGG - Intronic
1174198262 20:48788675-48788697 ATCCCCCACATTTCATGTGTTGG + Intronic
1174682194 20:52419624-52419646 GTCCCCCAAAATTTATATGTTGG + Intergenic
1174831173 20:53813496-53813518 GTCCCCCAAAGTTCGTATGTTGG + Intergenic
1174866327 20:54139542-54139564 TTCCCCCAAAATTCATATGTTGG - Intergenic
1175086641 20:56464988-56465010 GTCCCCCAAATTTCATGTGTTGG - Intergenic
1176378500 21:6099819-6099841 GTTCCCCAAAGTTCATGTGTCGG - Intergenic
1176917147 21:14639574-14639596 CTCTCCTAAAGTTCATGTGTTGG - Intronic
1176983323 21:15408021-15408043 TTCCCCTAAAGTTCATATTTTGG + Intergenic
1177185187 21:17785820-17785842 GTTCCCTGAAGTTCATGTGTTGG - Intergenic
1177187328 21:17812360-17812382 GTCCCTCAAAGTTCATGTTTTGG + Intronic
1177282306 21:18997423-18997445 GTCCCCCAAAGTTCATGTATTGG + Intergenic
1177324674 21:19568952-19568974 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1177478537 21:21655318-21655340 GTCCCCCAGAATTTATGTGTTGG - Intergenic
1177652664 21:23978871-23978893 GTCCCCCAAAATTCACATGTTGG + Intergenic
1177701955 21:24650850-24650872 GCCCCCAAAATTTCATGTGTTGG + Intergenic
1177745100 21:25202781-25202803 GTCCCCCAAATGGCATGTGTTGG - Intergenic
1177946645 21:27478997-27479019 GTCCCCCGAAATTCATGTGTTGG - Intergenic
1178135852 21:29626380-29626402 GTCCCCCAGAGTTCATGTGTTGG - Intronic
1178346154 21:31830063-31830085 ATCCCCACAAATTCATATGTTGG + Intergenic
1178458507 21:32778977-32778999 ATCCCCCAAAATTCATGTGTTGG + Intergenic
1178903206 21:36614278-36614300 GTCTCCCCAAGTTCATGTGTTGG + Intergenic
1178940822 21:36903797-36903819 GTCCTCCAAATTTCATGTGTTGG + Intronic
1179155453 21:38847099-38847121 GTCCCCCAGAATTCATGTATTGG - Intergenic
1179157760 21:38864737-38864759 GTCCTCCAAAGTTCAAGTTTTGG + Intergenic
1179381076 21:40899687-40899709 GTCCCCCACAATTCATGTGTTGG - Intergenic
1179744975 21:43438417-43438439 GTTCCCCAAAGTTCATGTGTCGG + Intergenic
1180166114 21:46030599-46030621 GTTCCACAAAATTCATGTGTTGG + Intergenic
1180308643 22:11150602-11150624 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1180547120 22:16512413-16512435 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1181004721 22:20007514-20007536 GTCCCCCAAAGTTCACGTGTTGG + Intronic
1181094901 22:20498061-20498083 TACCCCCAAAATTCATATGTTGG + Intronic
1181612523 22:24027523-24027545 ATCCCCCACAGTTTATATGTTGG + Intronic
1182054386 22:27338487-27338509 GTCCCCCAAAGTTGATGTGCTGG + Intergenic
1182196900 22:28528084-28528106 GCCCCCCAAATTTCATTTGTTGG - Intronic
1182212054 22:28684928-28684950 GTCCCCCAAAGTTCATGTGCTGG + Intergenic
1182418527 22:30236876-30236898 GTCCCCCAAATTTCATGTGTTGG - Intergenic
1182702416 22:32251264-32251286 GTACCACCAAGTTCATGTGTTGG + Intronic
1182804701 22:33059618-33059640 GTTCCCCAAAGTTCATATCTTGG + Intergenic
1182829267 22:33291481-33291503 GTCCCCCAACATTCATGTGTTGG + Intronic
1182847697 22:33445265-33445287 GTCCCCCAAAATTCATATGTGGG - Intronic
1183274949 22:36889004-36889026 GTCCCCTAAAATTAATGTGTTGG - Intergenic
1183705616 22:39473552-39473574 GTCCCCCAACGTTCACATGTAGG - Intronic
1183729845 22:39612009-39612031 GTCTCCCATAGTTCATGTGTTGG + Intronic
1183973105 22:41493247-41493269 GTCCCCCAAAGTTTATGTGTTGG - Intronic
1184007293 22:41719652-41719674 GTTCCCCAAAGTTCATGTGTTGG - Intronic
1184701768 22:46179209-46179231 ATCCCCCAAATTTCATGTGCTGG - Intronic
949210922 3:1499982-1500004 GTATCTCAAAGTTCATGTGTTGG - Intergenic
949212538 3:1522751-1522773 GTCCACTAAAGTTGATGTGTTGG + Intergenic
949224766 3:1681214-1681236 GTCCCCCAAAGTTCATTTGTTGG - Intergenic
949286345 3:2410204-2410226 GTCCCACAAAGTTCATGGGAGGG - Intronic
949618826 3:5787133-5787155 TCCCCCATAAGTTCATGTGTTGG + Intergenic
950157482 3:10733910-10733932 GTCTCCCAAAGTTCATATGCTGG + Intergenic
950319219 3:12034786-12034808 GTCTCCCAAAATTCATGTGTTGG - Intronic
950319584 3:12037769-12037791 GTCCCCCAAAGTTCTTATGTTGG - Intronic
950455077 3:13088001-13088023 GTCCCCCAAAGTTCATGCATTGG - Intergenic
950818297 3:15730810-15730832 GTCCTCCGAAGTTCATATGTTGG + Intronic
950839692 3:15955476-15955498 GTCCTCCAAAGTTCATGCGTTGG - Intergenic
951203886 3:19904915-19904937 ATCTTCCAAAGTTTATGTGTTGG + Intronic
951284575 3:20793562-20793584 GTCCTCCAAAGTTCATGTGTTGG - Intergenic
951419953 3:22472269-22472291 GTCCCCTAAATTTCATATGTTGG - Intergenic
951480300 3:23154221-23154243 GTTCTCCAAAGTTCATGTGTTGG - Intergenic
951624812 3:24647390-24647412 TCTCCCAAAAGTTCATGTGTTGG - Intergenic
951688489 3:25371118-25371140 ATCTCCCAACATTCATGTGTTGG + Intronic
951741181 3:25925359-25925381 GTCCCCCAAAGTTTACATGTTGG - Intergenic
951891111 3:27568978-27569000 GTCCCTCAAAGTTCACGTGCTGG + Intergenic
951961026 3:28320548-28320570 TCCCCCAAGAGTTCATGTGTTGG - Exonic
952327878 3:32337209-32337231 GTCCCCCAAACTTTATGTGTTGG - Intronic
953656134 3:44856286-44856308 AATCCCCAAACTTGATGTGTAGG + Intronic
953731215 3:45449611-45449633 GTCCCCCAAAGTTCATGTGTTGG - Intronic
953753249 3:45625552-45625574 GCCCCCCACAGTTCAAGTGTTGG + Intronic
953898864 3:46826884-46826906 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
954354495 3:50073551-50073573 GTCCCTCAAAGTACATATGTTGG - Intronic
954928656 3:54260608-54260630 GTCCCCCGAAGCTCATGTGTTGG - Intronic
954934958 3:54317992-54318014 GTCCCCCAAAGTTCATGTATTGG - Intronic
955026950 3:55176842-55176864 GTCCCCCAAAATTCATGTGTTGG - Intergenic
955112967 3:55967659-55967681 GTCCCCCAAAGTTCATGAGTAGG + Intronic
955118859 3:56035468-56035490 ATCCCTCAATATTCACGTGTTGG + Intronic
955137580 3:56234915-56234937 GTCCCCCTAAATTTATGTGTTGG - Intronic
955274602 3:57535232-57535254 TCCCCCAAAAGTTCACGTGTTGG + Intronic
955636679 3:61037542-61037564 GTCACCCAAAGTCCATGTGTTGG + Intronic
955639397 3:61066267-61066289 GTCCCCCAGAGTTTATGTTTTGG - Intronic
955691687 3:61597239-61597261 GTCGCCCAAAGGTCATGTGCTGG - Intronic
955744806 3:62129714-62129736 ATCCCCAACATTTCACGTGTTGG - Intronic
955944724 3:64182088-64182110 GTACCCCCAAATTCATGTGTTGG + Intronic
955986814 3:64582236-64582258 TTCCCCAGAAGTTCATGTATAGG + Intronic
956158384 3:66322069-66322091 GTCCCCCAAAGTTCATGTGCTGG - Intronic
956256012 3:67283849-67283871 ATTGCCCAAAGTTCGTGTGTTGG - Intergenic
956334827 3:68151771-68151793 GTTCCCCAAAGTTCATGTGATGG - Intronic
956426536 3:69141431-69141453 GTCCTCTAAAGTTCATGTGTTGG + Intergenic
956762312 3:72454926-72454948 GTCCCCCACAATTCATGCGTTGG + Intergenic
956765471 3:72480977-72480999 GTCCCCCAAAATTCATGTGTTGG + Intergenic
957122585 3:76114201-76114223 GTCTCCCAAAGTTCATGTGTTGG - Intronic
957218913 3:77357173-77357195 GTCACCCAAAGTTCATGTGATGG + Intronic
957253935 3:77812316-77812338 ATTCCCTAAACTTCGTGTGTTGG - Intergenic
957304346 3:78437668-78437690 CTCCCTCCAAATTCATGTGTTGG - Intergenic
957410882 3:79838320-79838342 GTCCCCCAAATTTCATATGTTGG + Intergenic
957813883 3:85265660-85265682 GTCCCCCAAAGTTCATGTGTTGG - Intronic
957835096 3:85577234-85577256 GTCCCCCGGAGTTCATGTGTTGG + Intronic
958484365 3:94684814-94684836 ATGCCCCAAAACTCATATGTCGG + Intergenic
958555609 3:95672689-95672711 GTCCCCCAAAGTTCATGTGGTGG - Intergenic
958843476 3:99237195-99237217 GTTCCCTAAAGTTCATGTGTTGG - Intergenic
959090281 3:101895318-101895340 TCCCTCAAAAGTTCATGTGTTGG + Intergenic
959196499 3:103189150-103189172 GTCCCTCAAATTTCATGTGTTGG + Intergenic
959240411 3:103784759-103784781 TGCCCCCAAAGTTCATATGTTGG - Intergenic
959558652 3:107753400-107753422 ATTCCCAAAAGGGCATGTGTGGG - Intronic
959578372 3:107959573-107959595 TTCCCAAAAAGTTCATGTGTTGG - Intergenic
959633863 3:108539107-108539129 TTTCCCCAAAGTTCATGTGTAGG - Intergenic
959707218 3:109349200-109349222 GTCCCCCAAAATTCATATCTTGG - Intergenic
959798561 3:110462459-110462481 GTACCCCAAAATTCATGTGTTGG - Intergenic
960142709 3:114166339-114166361 GTCCCCCAAAAGGCATGTGTTGG + Intronic
960145734 3:114199540-114199562 GTCCCCCAAAGTTTGTGTGTTGG - Intergenic
960172331 3:114476760-114476782 GTCTCCAAAAGTTCTTGTGTTGG - Intronic
960214109 3:115009594-115009616 ATCCCTCAAAGTTCATGTGTTGG + Intronic
960231975 3:115238926-115238948 GTCCTCCAAAATTCTTGTGTTGG - Intergenic
960392373 3:117093135-117093157 GTCGCCCAAAATTCATGAGTTGG - Intronic
960593148 3:119384745-119384767 GTCCCCCAAAGTTCATGTGTTGG - Intronic
960645465 3:119876660-119876682 GTCCCCCAAAGCTCATGTGTTGG + Intronic
960772095 3:121205506-121205528 GTCCCCCAAAATTCATGTGTTGG - Intronic
960806649 3:121590259-121590281 GTCCCCCACAGCTCATGCGTTGG + Intergenic
961060150 3:123821873-123821895 GTCCCCCAGAATTCATGTTTTGG + Intronic
961314079 3:126022644-126022666 GTCCCCCACATTTCATGTGTTGG - Intronic
961739594 3:129024819-129024841 GTCCCCCAAAGTTCACGTGTTGG - Intronic
962004120 3:131331088-131331110 GTCCCCCAAGGTTCATGTGTTGG - Intronic
962067574 3:131998036-131998058 GTCCCCCAAAGTTCATGTGTTGG - Intronic
962077256 3:132095537-132095559 GTCCCCAAACGTTCATGTGTCGG - Intronic
962177496 3:133169224-133169246 TGACCCCAAAGTTCATTTGTTGG - Intronic
962306099 3:134287650-134287672 GTCCCCCAAAGGCCATGTGTTGG - Intergenic
962321481 3:134394159-134394181 GTCCCCCAGAATTCATGTATTGG - Intergenic
962436568 3:135372393-135372415 TGTCCCCAAAGTTCATGTGTTGG + Intergenic
962467506 3:135674014-135674036 GTCCCCCAAAATTCATGTGTTGG - Intergenic
962487905 3:135862851-135862873 GTCCCCGTAAGTTCATGTGTTGG + Intergenic
962592900 3:136908869-136908891 GTACCCCAAAGTTAATGTGTTGG + Intronic
962803054 3:138906606-138906628 TGTCCCCGAAGTTCATGTGTTGG - Intergenic
963254291 3:143129682-143129704 AACCCCCAAATTTCCTGTTTGGG - Intergenic
963526025 3:146414265-146414287 GTTCACCAAAGTTCATGTGCTGG - Intronic
963845897 3:150157857-150157879 ATCTCCTAAAGTTCATGTGTTGG - Intergenic
964145912 3:153463274-153463296 ATCCCCCAAGTTTCATGTGTTGG + Intergenic
964325821 3:155544421-155544443 GTCTCCCAATGTTAATGTGTGGG - Intronic
964578967 3:158209154-158209176 GTCTCCCAAAGTTTTTGTGTTGG + Intronic
964627159 3:158770812-158770834 GTCCCTCAAGTTTCATGTGTTGG + Intronic
964648212 3:158981538-158981560 GGCCCCCAAAGTTGATTTGTGGG - Intronic
964905654 3:161716912-161716934 GTCCTCCAAAATGCATGTGTTGG - Intergenic
965000379 3:162945309-162945331 TTTCCCCAAAGCGCATGTGTTGG + Intergenic
965756532 3:172033312-172033334 CTCCCCCAAGCTTCATGTGTTGG - Intergenic
965815300 3:172630030-172630052 ATGCCCCAAAGGAGATGTGTTGG + Intergenic
965859742 3:173134237-173134259 TCCCCTAAAAGTTCATGTGTTGG + Intronic
966029425 3:175326889-175326911 GTACCCCACAGCTCATGTGTTGG - Intronic
966172826 3:177101411-177101433 GTCCCTCAAATTTCATGTGTTGG + Intronic
966227758 3:177616480-177616502 TCCCCCAAAAGTTCATGTGTTGG + Intergenic
966393749 3:179479908-179479930 TTTCCCAAAAGTTCATGTTTTGG + Intergenic
966492077 3:180539301-180539323 GTCCCCCAAAACTCATGTGCTGG + Intergenic
966555638 3:181257380-181257402 TGCCCCCAAAGTTTATGTGTTGG - Intergenic
966762715 3:183431444-183431466 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
967701229 3:192594529-192594551 GTCCCCCAAGTTTCATGTGTTGG + Intronic
968366807 3:198191942-198191964 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
968624699 4:1621861-1621883 GTCCCCCAAGGCTCATGTGTTGG + Intronic
968733257 4:2281681-2281703 GTGCCCCAAAGTTCATGTGTTGG - Intronic
968840316 4:2999434-2999456 GTGCCCCAAAGTTCATGTGTTGG - Intronic
969147194 4:5134219-5134241 GTTCCCCAAAGTTTATGTGTTGG + Intronic
969375832 4:6762622-6762644 GTCCCCCAAAATTCTTATGTTGG + Intergenic
970111736 4:12645233-12645255 CTTCCCCAAGGTTTATGTGTTGG - Intergenic
970155869 4:13141377-13141399 TACCCCCAAAATTCATATGTGGG + Intergenic
970197116 4:13562079-13562101 GTCCTCCAAAGTTCATAGGTTGG - Intergenic
970504985 4:16719624-16719646 GTCCCCGAAAGTTCATGTGTTGG + Intronic
970505329 4:16723529-16723551 ATTCCCCAATGTTCATGTATTGG - Intronic
970576520 4:17434099-17434121 TCCCCCAAAAGTTCATGTGTTGG - Intergenic
971078816 4:23182998-23183020 GTCCCTCAAAGTTCATGTACTGG - Intergenic
971117182 4:23662294-23662316 TTCCCCCAAAAAGCATGTGTTGG + Intergenic
971194108 4:24455569-24455591 GTCCCCCAAAGTTCAAGTGTTGG + Intergenic
971214771 4:24652726-24652748 ATCCCCCAAAGTTCATCTGTTGG - Intergenic
971302764 4:25455661-25455683 GGCCCCCAAAGTTCATGTGTTGG - Intergenic
971465159 4:26950426-26950448 GTTCCCCAAAATTTATGTGTTGG + Intronic
971933952 4:33122608-33122630 TCCCCAAAAAGTTCATGTGTTGG - Intergenic
971993693 4:33935458-33935480 GTTCCCCAAAGTTTGTGTGTTGG + Intergenic
972342857 4:38167569-38167591 TTCCCCCCAGATTCATGTGTTGG - Intergenic
972370934 4:38422588-38422610 GTCCCCTAAAGTTCATGTGTTGG - Intergenic
972566593 4:40274992-40275014 TCCCCCCAAAGCTCATGTGTTGG - Intergenic
972622507 4:40761933-40761955 GTCCCCCAGAATTCATGTATTGG + Intronic
972668169 4:41188364-41188386 CCCCTCCAAAATTCATGTGTTGG + Intronic
972851036 4:43051264-43051286 GTTCCCTAATGTTCATGTGTTGG + Intergenic
973738248 4:53893636-53893658 GTTCACCAAAGTTCATATGTTGG - Intronic
974024539 4:56721846-56721868 GTCCCCCAAAGTTCATGTGCTGG + Intergenic
974095801 4:57362457-57362479 ATCCACCAAAATTCATGTGTTGG - Intergenic
974159068 4:58113375-58113397 ATCCACCGAAGCACATGTGTTGG - Intergenic
974246772 4:59330346-59330368 TTCTCTAAAAGTTCATGTGTTGG + Intergenic
974355911 4:60812486-60812508 TTTCCCCAAAGTTCATGTGTTGG - Intergenic
974389024 4:61240352-61240374 GTACCCCAAAATTCATATGTTGG - Intronic
974514150 4:62886624-62886646 GCCCCCCAAAGTTCATGTGTTGG + Intergenic
975044678 4:69786914-69786936 GTCCCTCAGAGTTCATGTGTTGG + Intronic
975231207 4:71935674-71935696 GTTCCTCAAAGTTCATATGTTGG + Intergenic
975859885 4:78665605-78665627 GTCTCCCAAAGTTCATGTGTTGG + Intergenic
975902651 4:79171119-79171141 GTCTCCAAAAGTTCATGTGTTGG + Intergenic
975985573 4:80198607-80198629 ATCCCCCAAATGTCAAGTGTTGG - Intronic
976153941 4:82122358-82122380 GTCCCCCGAAGTTCATGTGTTGG - Intergenic
976172057 4:82314515-82314537 GTCCCACAAAGTTCATGTATTGG - Intergenic
976224092 4:82781543-82781565 GTCTCCCTAAGTTCATGTGTTGG + Intronic
976376348 4:84349944-84349966 GTTCCCCAAATTTCATGTGTTGG - Intergenic
976446492 4:85135851-85135873 GCCTCCCAAAGCTCATGTGTTGG - Intergenic
976539864 4:86262084-86262106 GTCCTCCAAAGTTCCTGTGTTGG + Intronic
976566700 4:86559180-86559202 ATCCCCAAAAATTTATGTTTAGG + Intronic
976632998 4:87258754-87258776 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
976841200 4:89434034-89434056 ATCCCCCAAAGTTCATGTATTGG + Intergenic
976953461 4:90864311-90864333 GTCCCCCAAAGTTCATGTGTTGG + Intronic
977067376 4:92334731-92334753 GTCCCCCAAAATTTATGTGTTGG - Intronic
977073048 4:92417363-92417385 GTTCCCCAAAATTCATGTGTTGG + Intronic
977134245 4:93282649-93282671 GTCCCCAAAAGCTCATGTGTTGG - Intronic
977192135 4:94014184-94014206 GTCCCTCAAATTTCATGTGTTGG - Intergenic
977192721 4:94021008-94021030 ATCCCCCAAAGTTTATGTGTTGG + Intergenic
977320101 4:95503063-95503085 GTCTCCCAAAATTCATGTGTTGG + Intronic
977421389 4:96804548-96804570 TTCCGCCAAAGTTCATGTGTTGG + Intergenic
977903921 4:102454665-102454687 GTTCCCCAGATTTCATGTGTTGG - Intergenic
977904189 4:102456628-102456650 ATCCTCCAAATTTGATGTGTTGG - Intergenic
977907494 4:102494834-102494856 GTCCCCCAAAGTTCCTGTGTTGG - Intergenic
977983652 4:103356917-103356939 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
978028567 4:103910118-103910140 GTCCCCCAAAATTCATGTGATGG + Intergenic
978330248 4:107604633-107604655 GCCTCCCAAAGTTCATGTGTTGG - Intronic
978338912 4:107700532-107700554 GTCTCTCAAAGTTCATGTGTTGG + Intronic
978524596 4:109652731-109652753 GTCCCCCAGAGTCCATGTGTTGG - Intronic
978526771 4:109675624-109675646 GTTTCCCAAAGTTGATGTGTTGG + Intronic
978535239 4:109755418-109755440 GTTCCCCAAAGTTCATGTGTTGG + Intronic
978561655 4:110040599-110040621 GTCCCATAAAGTTCATGTGTTGG + Intergenic
978723465 4:111942265-111942287 TGTACCCAAAGTTCATGTGTTGG - Intergenic
978780348 4:112546494-112546516 GTCCCTCAAATTTCATGTGTTGG + Intronic
978936002 4:114376874-114376896 GTCCTACAAAGTTCATGTGTTGG + Intergenic
979169198 4:117578528-117578550 GTCTCTCAAAGATCATGTGTTGG + Intergenic
979180929 4:117726227-117726249 CCCCCCCAAAATTCATGTTTTGG - Intergenic
979255220 4:118601551-118601573 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
979333116 4:119438957-119438979 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
979415963 4:120439275-120439297 GCCCCCCCAAATTCATGTGTTGG + Intergenic
979418190 4:120469682-120469704 GTCCCCCAAATTTTATGTCTTGG + Intergenic
979525950 4:121717142-121717164 GTCCCCCAAAGTTTATATGCTGG - Intergenic
979593420 4:122506239-122506261 TTTCCCCATAATTCATGTGTTGG - Intergenic
979616387 4:122747490-122747512 TCCCCCCAAAATTTATGTGTGGG + Intergenic
979860393 4:125686275-125686297 GTTTCCCAAAGTTCATGTATTGG - Intergenic
979962027 4:127032815-127032837 ATCCCCCAAAAAGCAGGTGTTGG + Intergenic
980041745 4:127948051-127948073 GTCCCCCAAATTTCATTTTTTGG + Intronic
980049441 4:128024392-128024414 GTCCCCCAAAGTTCATGTGTTGG - Intronic
980123589 4:128752195-128752217 GTCCCCCAAAGTTCATGTGTCGG + Intergenic
980237480 4:130128226-130128248 GTTCTCCAAATTTCATGTGTTGG + Intergenic
980311253 4:131132517-131132539 GTCCCCCAAAATTTATGTGTTGG + Intergenic
980452882 4:132998241-132998263 ATCCCCAAAGGTTCATGTGTTGG - Intergenic
980561820 4:134487204-134487226 GTTCCCCACAGTTCATGTTTAGG - Intergenic
980621366 4:135308994-135309016 TCCCCCCAAAATTCATTTGTTGG + Intergenic
980627711 4:135395341-135395363 ATCCCAGAAAATTCATGTGTTGG + Intergenic
980763667 4:137270348-137270370 GTCCCCCAAATTTTATATGTTGG - Intergenic
980779115 4:137474051-137474073 CTCCCCCAAAGTACATGTTTTGG - Intergenic
980885310 4:138756244-138756266 GTCTCCCCAAATTCATGTGTTGG - Intergenic
980899793 4:138893832-138893854 GTCCCCCAAATTTCATGTGTTGG - Intergenic
981350368 4:143722342-143722364 GCCCCTCAAAGTTCATGTGTTGG - Intergenic
981403935 4:144344706-144344728 GTTCCCTAAAGTTCATGTGCTGG - Intergenic
981480002 4:145228775-145228797 TCCCCCAAAATTTCATGTGTTGG + Intergenic
981515994 4:145610905-145610927 GTTCCCCAAAGTTAATGTGTTGG + Intergenic
981548135 4:145915587-145915609 GTCCCCCAGAATTCATATGTTGG - Intronic
981620753 4:146695765-146695787 ACCCCCAAAAGTTCATGTGTTGG - Intergenic
981621395 4:146703611-146703633 GTTCCCCAAAGTTCACGTGTTGG - Intergenic
981704979 4:147649367-147649389 CTCCTCCAAAGCTCATGGGTTGG - Intronic
981796677 4:148603955-148603977 CTCCCACAACATTCATGTGTTGG + Intergenic
981796973 4:148606333-148606355 TACCCCCAAAGTTCATGTGTTGG + Intergenic
981921101 4:150085582-150085604 ATCTCCCAAGCTTCAGGTGTTGG - Intronic
981928513 4:150165765-150165787 TCCCCCAAAAGTTCATGTGTTGG + Intronic
981961850 4:150550945-150550967 ATCCCCCAAAGTTCATGTGTTGG + Intronic
982086203 4:151839345-151839367 TGCCCCCACAATTCATGTGTTGG + Intergenic
982281417 4:153686289-153686311 GTGCCCCAAAGCTCATGTATTGG - Intergenic
982286960 4:153745912-153745934 GTTCCCCAAAGTTCATGTGTTGG - Intronic
982287246 4:153748159-153748181 ATCCCCCAAAGTTCTTGTGTTGG - Intronic
982290592 4:153778329-153778351 ATCCCCTAAAATTCATGTGTTGG + Intergenic
982400680 4:154964237-154964259 GTTCCTCAAAATTCATGTGTTGG - Intergenic
982453872 4:155584820-155584842 CTCCTCCAAAATTCATATGTTGG - Intergenic
982787310 4:159550702-159550724 TTCCCCCAAAGTTCATGTGTTGG - Intergenic
982885886 4:160782565-160782587 ATCCACAAAAGTTCATGTGTTGG - Intergenic
982977097 4:162077365-162077387 GGTCCCCAAAGTTTATGTGTTGG - Intronic
982994242 4:162320302-162320324 TTCCCCCAAAGTTCATGTGTTGG - Intergenic
983021586 4:162683254-162683276 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
983026886 4:162749131-162749153 TTCCCCAAAAGATCATGTGAGGG + Intergenic
983187300 4:164714883-164714905 ATCTCCCAAAGTTCACATGTTGG + Intergenic
983283922 4:165715551-165715573 GTCCCCCAAAATTCATGTGTTGG + Intergenic
983392189 4:167146345-167146367 GTCTCCCACAGTTCTTGTGTGGG - Intronic
983413773 4:167429238-167429260 GTCCCCCAAAGTTCAGATGTTGG - Intergenic
983475827 4:168210757-168210779 GTCCCCCAAATTTCATGTTTTGG + Intergenic
983574200 4:169242592-169242614 GTCACCCAAAATTCATGTATTGG + Intronic
983671246 4:170240315-170240337 GTTCACCAAAGTTTATGTGTTGG - Intergenic
983822391 4:172211943-172211965 TTCCCCAAAAATTCATATGTTGG - Intronic
983884879 4:172969733-172969755 GTCCCCCAAAGTTCATGTGTTGG + Intronic
983898704 4:173109417-173109439 TTCTCCCAAAATTCATATGTTGG - Intergenic
984103492 4:175515780-175515802 TGCCCCCAAAGTTGATGTGTTGG + Intergenic
984147412 4:176080063-176080085 ATCCCCTACATTTCATGTGTTGG - Intronic
984204697 4:176772577-176772599 GTTCCCCAAACTTCATGTGTTGG + Intronic
984309500 4:178038699-178038721 TTCTCCCAAAGTTCATGTGTTGG - Intergenic
984389339 4:179109209-179109231 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
984426304 4:179591266-179591288 ATCTTTCAAAGTTCATGTGTTGG + Intergenic
984523786 4:180831844-180831866 TTCCTCCAAAATTCATATGTTGG - Intergenic
984562849 4:181291374-181291396 ATCCCCCTGAGCTCATGTGTAGG + Intergenic
984595864 4:181667424-181667446 ATCCCCCAAAAAGCATGTGTTGG + Intergenic
984756455 4:183329711-183329733 GTCCCCTAAAGTTCATATGTTGG - Intergenic
984789186 4:183599215-183599237 GTCCCCCAAAATTTATGTGTTGG + Intergenic
985037555 4:185856619-185856641 ATGCCCCAAATTTAATGTGGTGG + Intronic
985073060 4:186187488-186187510 GTGCCCCAAAGTTCATGTGTTGG + Intergenic
985325744 4:188767788-188767810 GTACCCCAAAATTCATGTGTTGG - Intergenic
985733163 5:1562885-1562907 GTCCCCCAAAATCCATGTGTTGG - Intergenic
985771174 5:1812338-1812360 CTCCCCCAAAGTTCCTCTGTTGG - Intronic
986197771 5:5553763-5553785 TTCCCCCCAAATTCATATGTTGG + Intergenic
986672601 5:10156408-10156430 GTCTCCCAAAATTGATGTGTTGG - Intergenic
986677170 5:10196177-10196199 GTCCCCCCAAATTCATATGTTGG - Intergenic
986748891 5:10767498-10767520 GTCTCCCAAAATTCATGTGTTGG + Intergenic
986801052 5:11260736-11260758 GTCCCTCAAAATTCCTGTGTTGG - Intronic
986874349 5:12088978-12089000 GCCCCCCAAATTTCATGTGTTGG - Intergenic
987041905 5:14070760-14070782 ATCTCCCAAAGTTGATGTGTTGG - Intergenic
987150564 5:15035204-15035226 GTCTCCCAAGGCTCATGTGTAGG - Intergenic
987154826 5:15078519-15078541 GTCTGCCAAAGTTCATGTGTTGG + Intergenic
987173163 5:15279927-15279949 TTCCCCCAACATTCATATGTTGG + Intergenic
987178391 5:15340399-15340421 GCCCCCAAAAGTTTATGTGTTGG - Intergenic
987271901 5:16318655-16318677 GTCCCCCAAAGTTTATATGTTGG + Intergenic
987477711 5:18412061-18412083 ATTCTGCAAAGTTCTTGTGTTGG + Intergenic
987477764 5:18412894-18412916 ATCCTCCAAAGTTCATGTGCTGG + Intergenic
987551561 5:19389098-19389120 GTGCCCCAAAATTCATGTGTTGG + Intergenic
987594659 5:19981648-19981670 GTCCCTCAAAATTCATGTCTTGG - Intronic
987647927 5:20699994-20700016 GTCCCTCAAAATTCATGTGTTGG - Intergenic
987648348 5:20706458-20706480 GTCCCCCAAAGTTTATGTGTTGG + Intergenic
987859913 5:23471332-23471354 GTCCCTTAAAGTTCATGTGTAGG - Intergenic
987900111 5:24000084-24000106 GTCCCTCAAAGTTCCTGTGTTGG + Intronic
987969713 5:24927017-24927039 GTTGCCCAAAATTCATGTGTTGG + Intergenic
988146117 5:27310929-27310951 ATCACCCAAAATTCCTCTGTTGG - Intergenic
988241066 5:28609838-28609860 TTCCCCCAAAGTTTATGTGTTGG + Intergenic
988326439 5:29774583-29774605 GTCCCCCACAGCTCATGTGTTGG + Intergenic
988414471 5:30928559-30928581 TTCCCCCAAAATTGATATGTCGG - Intergenic
988747978 5:34162455-34162477 GTCCCCCAAAGTTTATGTGTTGG - Intergenic
988748411 5:34168866-34168888 GTCCCTCAAAATTCATGTGTTGG + Intergenic
988888672 5:35589296-35589318 ATCTCCCAAAGTAAATGTATTGG - Intergenic
989016417 5:36939928-36939950 GTCCCCCAAAGTTCATTTGTTGG - Intronic
989350366 5:40479189-40479211 GTCCCCCAAAGTTGATGTGTTGG + Intergenic
989398611 5:40984992-40985014 GTTTCCCAAAGTTCATGTGTTGG - Intergenic
989407943 5:41082732-41082754 ATCTCTCAAAGTTTATGTGTTGG + Intergenic
990146583 5:52767656-52767678 GTTCCCCAAATTTCATGTGTTGG - Intergenic
990164749 5:52982063-52982085 GTCCCCCCAAATCCATGTGTTGG - Intergenic
990319267 5:54613552-54613574 GTCCTCCAAAGTTCTTGTGTTGG - Intergenic
990424642 5:55674320-55674342 GTCCCCCAAAGTTTATGTGTTGG + Intronic
990477995 5:56180277-56180299 TTCCCTCAAATTTCATGTGTTGG - Intronic
990599913 5:57347764-57347786 TCCCCCAAAAGTTCATGTGTTGG - Intergenic
991190598 5:63868618-63868640 GCCCCTCAAAATTCATGTGTTGG + Intergenic
991604443 5:68386266-68386288 GTCCTCCAAAGATCATGTGTTGG + Intergenic
991917334 5:71618180-71618202 TCCCCCAAAAGTTTATGTGTTGG + Intronic
992000443 5:72431083-72431105 GTCCCTCAAAGTTCATGTGTTGG + Intergenic
992011374 5:72531044-72531066 GTCCCCTAAAATGCATGTGTTGG - Intergenic
992113665 5:73519335-73519357 ATCCCCCAAATTTCATGTGTTGG - Intergenic
992270576 5:75058845-75058867 GTTCTCCAAAGTTCATGTGTTGG - Intergenic
992393676 5:76352334-76352356 TGCCCCCAAAGTTCACGTGTTGG + Intronic
992400995 5:76411447-76411469 ATTCCCCAAAGTTCGTGTGTTGG + Intronic
992485945 5:77195347-77195369 TCCCCCCAAAATTCATGTGTTGG - Intergenic
992655207 5:78902290-78902312 TCTCCCAAAAGTTCATGTGTTGG - Intronic
992776036 5:80090141-80090163 GCCCCCTGAAGTTCATGTGTTGG + Intergenic
992881999 5:81119504-81119526 GTCCCCTAAAGTTCATATGTTGG - Intronic
993121155 5:83775587-83775609 CACCCCTAAAATTCATGTGTTGG - Intergenic
993476569 5:88373748-88373770 GTCCCCTAAAGTTCATGTGTTGG + Intergenic
993587916 5:89755319-89755341 GTCACCCAAATTTCATGTGTTGG + Intergenic
993664492 5:90678844-90678866 GTTCCCCAAAGTTCACATGTGGG - Intronic
993775393 5:91988697-91988719 GCTCCCCAAAGTTCACGTGTTGG + Intergenic
994083944 5:95738416-95738438 GTTCCCCAAAGTTCATGTGATGG + Intronic
994168080 5:96628944-96628966 TCCCCCAAAAGTTCATGTGATGG + Intronic
994247122 5:97490497-97490519 CTCCCCCAAAGGTCACATGTTGG + Intergenic
994343094 5:98654786-98654808 TTTCCCAAAATTTCATGTGTTGG - Intergenic
994560353 5:101362320-101362342 GTCCCCAAAATTTCCTGTGTTGG + Intergenic
994619496 5:102146212-102146234 GACCCCCAAAGTTCAGGTGTTGG - Intergenic
994733423 5:103522294-103522316 GTCCCCCAAAATTCATATGTTGG + Intergenic
995365301 5:111352852-111352874 GTTCCCCAAAGTTCATGTATTGG - Intronic
995366486 5:111367420-111367442 TCCTCCAAAAGTTCATGTGTTGG - Intronic
995383676 5:111565162-111565184 ATCCCGCAAATTTCATGTGTTGG + Intergenic
995572503 5:113495076-113495098 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
995614466 5:113945444-113945466 AGCCGCCAAAAATCATGTGTTGG + Intergenic
995737974 5:115323433-115323455 ATCCACCAAATTCCATGTATTGG - Intergenic
995780008 5:115764560-115764582 GTCCCCTAAAGTTCATGTGTTGG - Intergenic
995788193 5:115854240-115854262 CTCCCCCAAAGTTCATGTGTTGG - Intronic
995803726 5:116028098-116028120 GTCCCTCCAAGGTCATGTGTTGG - Intronic
996049304 5:118914138-118914160 GTCCCCTAGAATTCATGTGTTGG + Intronic
996363935 5:122680153-122680175 GTCCCCCACAGCTCATGCGTTGG + Intergenic
996480437 5:123969872-123969894 ATCCCCCAAAATTCATATGTTGG + Intergenic
996503548 5:124243311-124243333 GTTCTCCAAAATTCATGTGTTGG - Intergenic
996808325 5:127483229-127483251 GTCCCCCAAAAAGCATGTGTTGG - Intergenic
997075567 5:130671728-130671750 GTCCCTCAAAGTTCACGTGTTGG + Intergenic
997231664 5:132249188-132249210 GTCCCCCAGAGTTCATGTGTTGG - Intronic
997708451 5:135981473-135981495 GTCCCTCAAAATTCATGTATTGG + Intergenic
997989338 5:138531048-138531070 GTCCCCCCAAATTCATGTGTTGG + Intronic
998040592 5:138948738-138948760 TTCCCTAAAAGTTCAAGTGTTGG + Intronic
998057680 5:139092849-139092871 GGCCTCCAAAGTTCATGTGTTGG + Intronic
998295293 5:140964392-140964414 AGCCCCCAAATGTCATGTCTTGG - Intronic
998593749 5:143505772-143505794 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
998821496 5:146061868-146061890 ATCTCCCAATTTTTATGTGTTGG + Intronic
999001344 5:147926667-147926689 GTCCCCCAAAGTTCAAGTGTTGG - Intergenic
999158927 5:149478846-149478868 GTCCCCCAAAGCTCATATGTTGG - Intergenic
999356235 5:150934721-150934743 GCCCCTCACAGTTCATGTGTTGG + Intergenic
999535343 5:152510644-152510666 TCTCCCAAAAGTTCATGTGTTGG + Intergenic
999907818 5:156162882-156162904 ATCCCCCAGGGTTAGTGTGTGGG - Intronic
1000089304 5:157916507-157916529 GTCCCCAAAAGTTCATGTGTTGG + Intergenic
1000091097 5:157930289-157930311 GTCCCTCAAAGCTCATGTTTTGG - Intergenic
1000256390 5:159542462-159542484 GTCACCCAAAATTCATGTGTTGG + Intergenic
1000473130 5:161671258-161671280 TCTCCCTAAAGTTCATGTGTTGG - Intronic
1000682566 5:164204278-164204300 ATCCCCCCAAATTCATATGCTGG + Intergenic
1000826051 5:166044997-166045019 TCCCCCAAAAGTTCATGTATTGG - Intergenic
1001191241 5:169633820-169633842 CCCCCCCAAAGTTCATGAGTTGG + Intergenic
1001487750 5:172131799-172131821 ATCTCCCAAAAGGCATGTGTTGG + Intronic
1001793921 5:174485672-174485694 ATTCCCCAAAGATCATGTAGAGG - Intergenic
1001830873 5:174788375-174788397 TTCCCCCAAAGTTTATGTGTTGG - Intergenic
1002520085 5:179787801-179787823 TGCCCCAAAAGTTCATGTGTTGG + Intronic
1002726030 5:181297142-181297164 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
1002865525 6:1118850-1118872 GTCCCCCAAAGTTCATCTGTGGG + Intergenic
1002919881 6:1560456-1560478 GTTCCCCAAAGTTCCTGTGTTGG - Intergenic
1003263079 6:4540956-4540978 GTCCCCCAAAGTTCATGTATTGG + Intergenic
1003401954 6:5797878-5797900 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
1003529072 6:6922613-6922635 ATCCCCTAAAGCTCATGTGTTGG - Intergenic
1003584584 6:7375948-7375970 ATCCCCTAAAGTTAACGTGCCGG + Intronic
1003629688 6:7775150-7775172 GTCCCCCAAAGTTCATGTGTTGG - Intronic
1003839690 6:10107100-10107122 GTCCTCCAAAATTCATGTGTTGG + Intronic
1003896146 6:10609517-10609539 GTCCCCCAAAATTCATGTGTTGG - Intronic
1003898236 6:10628596-10628618 TCCCCCCAAAATTCATGTGTTGG + Exonic
1003980887 6:11388787-11388809 CCCCCCCAAAATTCATATGTTGG + Intergenic
1004066298 6:12247885-12247907 TCCCCCTAAAATTCATGTGTTGG + Intergenic
1004149424 6:13101387-13101409 GTCCCCCAAAGTTCAGGTGTTGG - Intronic
1004249923 6:14015393-14015415 GTTCCCCAAAGTTTATGTGTTGG - Intergenic
1004414595 6:15413906-15413928 GGCCCCCAAAGTTCATGTGTTGG - Intronic
1004880483 6:20002623-20002645 GTTCCCCAAAATTCATGTGTTGG + Intergenic
1004880805 6:20005527-20005549 GTCTCCCAAAGCTCATGTGGAGG - Intergenic
1004900687 6:20191067-20191089 TCCCTCAAAAGTTCATGTGTTGG + Intronic
1005229799 6:23686386-23686408 GTTCCCCAAAGTTTATGTGTTGG - Intergenic
1005393874 6:25361652-25361674 GTCCGCCAAATTTCATGTGTTGG + Intronic
1005545562 6:26865542-26865564 GTCCCCCAAAGTTTATGTGTTGG - Intergenic
1005545981 6:26871963-26871985 GTCCCTCAAAATTCATGTGTTGG + Intergenic
1005641657 6:27802076-27802098 GTCCCCCAAAATTAATGTGTTGG + Intergenic
1005716185 6:28550543-28550565 GTCCCCTAAAGTTCACATGTTGG + Intergenic
1005878478 6:30034537-30034559 GTTCCCCAAAGTTCATGTGTTGG + Intergenic
1005900011 6:30209374-30209396 TCCCCCAAAAGTTCACGTGTTGG + Intronic
1006196260 6:32244374-32244396 GTCTCCCAAAATTCATGTGTTGG + Intergenic
1006401765 6:33821858-33821880 GTCCCCCACAGTTCATGTGTTGG + Intergenic
1006791347 6:36703318-36703340 GTTCCCCAAAGTTCATGTGTTGG - Intronic
1006843135 6:37043807-37043829 GTCCACCAAAGTTCATGTGTTGG - Intergenic
1007012567 6:38431920-38431942 GTCCCTCAGAATTCATGTGTTGG + Intronic
1007187281 6:39982872-39982894 ATCCCTCAAAGTTCATGTGTTGG - Intergenic
1007209486 6:40180809-40180831 GTCCTCCAAAGTTCATGTGTTGG - Intergenic
1007246124 6:40464309-40464331 ATGCCTTAAAGTTCATGTGTTGG + Intronic
1007548445 6:42711070-42711092 GTCCCCCAAAGTTCCTGTGTTGG + Intronic
1007818403 6:44541494-44541516 GTCCCCCAAAATTCATGTGTTGG - Intergenic
1008180751 6:48325536-48325558 ATCCCCCAAAATTCCTATGTTGG + Intergenic
1008188553 6:48425320-48425342 GTTCCCCAAAGTTTATGTGTCGG - Intergenic
1008303284 6:49869761-49869783 TCCCCTCAAAGTTTATGTGTTGG + Intronic
1008330814 6:50241591-50241613 ATTCTTTAAAGTTCATGTGTTGG + Intergenic
1008504683 6:52218455-52218477 GTTCCCCAAATTTAATGTGTTGG + Intergenic
1008577521 6:52875408-52875430 TTTCCCCAAAATTCATATGTTGG + Intronic
1008842645 6:55922091-55922113 CTCCACCAAAGTGCATGTGATGG + Intergenic
1008897596 6:56575588-56575610 GTCCCCCAAAATTCATATATTGG + Intronic
1009016264 6:57906308-57906330 GTCCCCCAAAGTTTATGTGTTGG - Intergenic
1009016692 6:57912755-57912777 GTCCCTCAAAATTCATGTGTTGG + Intergenic
1009400630 6:63251246-63251268 GTCCCCAAAAGTTCATGTGTTGG + Intergenic
1009583506 6:65566959-65566981 TCCCCCCAGATTTCATGTGTTGG + Intronic
1009618735 6:66044618-66044640 GTCTCCCAAAATTCATATGTTGG + Intergenic
1009649738 6:66459993-66460015 GTGCCCCCAAGTGCATGTGTTGG + Intergenic
1009760255 6:67996201-67996223 TGTCCCCAAAGTTCATATGTTGG + Intergenic
1009786698 6:68349563-68349585 CCCCCCAAAAGTTTATGTGTTGG - Intergenic
1009966623 6:70585112-70585134 TTCCCCCAAAATTCATCTGTTGG + Intronic
1010156337 6:72798295-72798317 ATCCTGCAAAGTTTATGTGTTGG + Intronic
1010514805 6:76760263-76760285 CAGCCCCAAAGTTCATGTGTTGG - Intergenic
1010521117 6:76838986-76839008 GTCCCCCAAAATTCATGTGTTGG + Intergenic
1010881302 6:81177201-81177223 GCCCTCCAAAGTTCATGTGTTGG + Intergenic
1011330287 6:86197355-86197377 GTCCCCTAAAGTTCATGTGTTGG + Intergenic
1011439934 6:87376988-87377010 GTCCCTCAGATTTCATGTGTTGG + Intronic
1011709956 6:90043216-90043238 TCCCCCAAAAGTTCATGTGTTGG + Intronic
1011730544 6:90258159-90258181 ATTCCCCTATGTTCCTGTGTAGG + Intronic
1012140075 6:95615901-95615923 ATGCCCCAATACTCATGTGTTGG + Intergenic
1012290705 6:97452181-97452203 ACCCCCAAAAGTTCATGTGTTGG - Intergenic
1012473270 6:99594358-99594380 GTTCCCCAAAGTTCATGGGTTGG + Intergenic
1012593114 6:101006880-101006902 GTCCTCCAAAGTTCATGCATTGG + Intergenic
1012859266 6:104540063-104540085 GTCTGCCAAAGTTTATGTGTTGG - Intergenic
1012859422 6:104541576-104541598 ATCATCCAAAGTGCATGTGTTGG - Intergenic
1013015905 6:106160424-106160446 ATCACCCAAAGTACATCTGTGGG - Intergenic
1013307247 6:108860730-108860752 ATCCCCCTAACTACAGGTGTGGG - Intronic
1013346917 6:109269438-109269460 TCCCCCAAAAGTTCATGTGTTGG - Intergenic
1013427618 6:110028088-110028110 GTCCCCCAAAATTTGTGTGTTGG - Intergenic
1013486264 6:110599293-110599315 ATCCCTCAAATTTCATGTGTTGG + Intergenic
1013545203 6:111150052-111150074 GTCTCCCAAAGTTCATTTGTTGG + Intronic
1013684987 6:112570345-112570367 GTCCCCAAAATTTCATGTGTTGG + Intergenic
1013981002 6:116129359-116129381 ATCCCCCAAAGTTCATGTGTTGG + Intronic
1014109063 6:117600432-117600454 GTCCCCCAAATTTCGTGTATGGG - Intronic
1014346177 6:120272484-120272506 ATCCCTCAAGATTCATGTGTGGG - Intergenic
1014482930 6:121961102-121961124 GTCCCCCAAAGTTCAGGTATTGG + Intergenic
1014706973 6:124759729-124759751 TTCTCCCAACATTCATGTGTTGG + Intronic
1014783625 6:125592931-125592953 ATCCCACAAATTCCATGTGTTGG + Intergenic
1014853210 6:126367042-126367064 GTCACCCAAAATGCATGTGTTGG - Intergenic
1015137881 6:129894537-129894559 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1015203364 6:130607116-130607138 GTCTCCCAAAGTTTATGTGTTGG + Intergenic
1015439597 6:133232805-133232827 TATCCCCAAATTTCATGTGTTGG - Intergenic
1015518862 6:134112138-134112160 GTGCCCCAAAGTTTATGTGTTGG + Intergenic
1015551159 6:134413842-134413864 TCTCCCAAAAGTTCATGTGTTGG - Intergenic
1015615602 6:135071359-135071381 TCCCCCAAAAGTTCATGTGTTGG - Intronic
1015665744 6:135626545-135626567 GTCCTCCAAAGTTCATGTGTTGG + Intergenic
1015810300 6:137155699-137155721 TCCCCCAAAAGTTCATGTGTTGG - Intronic
1015839166 6:137457764-137457786 GGCCCCCAAAATTCATATGTTGG - Intergenic
1015839369 6:137460468-137460490 GGCCCCCAAAATTCATATGTTGG - Intergenic
1015926444 6:138314385-138314407 GTCCCCCAACATTCATGTGTTGG - Intronic
1016465899 6:144325180-144325202 GTCCCCCGAATTTCATGTTTTGG + Intronic
1016526711 6:145010032-145010054 TCCCCCCAAAATTCATGTATTGG + Intergenic
1016563239 6:145421030-145421052 ATCCCCAAAAGTTCATGTGTTGG - Intergenic
1016652894 6:146483638-146483660 TTCCCCCAAATTTCACATGTTGG - Intergenic
1016906250 6:149153305-149153327 GTCCCCCAAAGTGCATGTGTTGG + Intergenic
1017033722 6:150248217-150248239 GTCCTCCAAATTTCATGTATTGG - Intronic
1017468172 6:154714432-154714454 GTCCTCCAAATTTCATGCGTTGG + Intergenic
1017521239 6:155205124-155205146 ATCCCCCAGAATTCACATGTTGG - Intronic
1017561182 6:155629578-155629600 GTCTTCCAAAGTTCATGTGTTGG - Intergenic
1017740630 6:157403645-157403667 AGCCCCTAAAGTTAATTTGTAGG - Intronic
1017768334 6:157625152-157625174 GTCCCCCGAAGTTCGTGTGTTGG - Intronic
1018004035 6:159603633-159603655 TGTCCCCAAAGTTCATGTGTTGG - Intergenic
1018045347 6:159960892-159960914 CTCTCCCAAAGTTCATATGTTGG - Intergenic
1018175130 6:161171936-161171958 GTCCCCCAGAGTTCATGTGTTGG - Intronic
1018269957 6:162066438-162066460 GTCCCCTAAAATTCATGTGTTGG + Intronic
1018296092 6:162345841-162345863 GTCCCTCAAATTTCATATGTTGG + Intronic
1018320304 6:162601306-162601328 TCCCCCAAAAGTTCATGTTTTGG - Intronic
1018502827 6:164430671-164430693 TTCCTCCAAAATTAATGTGTTGG + Intergenic
1019002344 6:168764745-168764767 GTCCCTGAAAGCTCATGTGTTGG + Intergenic
1019804634 7:3114296-3114318 GTCCCCCAAAGTCCATGTGTTGG + Intergenic
1020430134 7:8110159-8110181 ATCCCCCAAAGTTCATGTGTTGG + Intergenic
1020630627 7:10635454-10635476 ATCCCCCAAAAAGCATGTGCTGG - Intergenic
1020738854 7:11987626-11987648 TTACCCCAAATTTCTTGTGTTGG + Intergenic
1021817748 7:24464747-24464769 GTTCCCCAAAGATCATGTCTTGG - Intergenic
1023029717 7:36081454-36081476 GTCCCCCAGTGTTCATGTGTTGG + Intronic
1023089470 7:36604203-36604225 TCCCCCCAAAATTCATATGTTGG - Intronic
1023388301 7:39682620-39682642 GTCCTGCAAATTTCATGTGTTGG + Intronic
1023397318 7:39763368-39763390 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
1023729459 7:43176765-43176787 GTCCCCAAAAGTCAATGTGTTGG - Intronic
1024070923 7:45784709-45784731 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
1024126354 7:46300965-46300987 ATTCCCCAGAGTACATTTGTTGG - Intergenic
1024397072 7:48881947-48881969 GTCCCCAAAAGTTCATATGTTGG - Intergenic
1024480810 7:49860671-49860693 TTCCCCCAAAATTTATATGTTGG + Intronic
1024585152 7:50835691-50835713 GTCCCCCAAAATTCATATGTTGG - Intergenic
1024660467 7:51488143-51488165 CTCTCCCAAAGTTCATATGTTGG + Intergenic
1024710848 7:52012793-52012815 GTCCCCCAAAGTTCATGTGTTGG + Intergenic
1024738864 7:52334465-52334487 AATCCCCAAGCTTCATGTGTAGG + Intergenic
1024951782 7:54868862-54868884 GTCCCCCAAAAAGCATGTGTTGG + Intergenic
1025002645 7:55329883-55329905 GTCCCCCAAAATTCAAGTGTTGG - Intergenic
1025058299 7:55783053-55783075 ATCCCCCAAAGTTCACGTGTTGG - Intergenic
1025135352 7:56407097-56407119 GTCCCCCAAAGTTTATGTGCTGG - Intergenic
1025828113 7:65026932-65026954 ATCCTCCAAAGTTCATGTGTTGG + Intergenic
1025915643 7:65863365-65863387 ATCCTCCAAAGTTAATGTGTTGG + Intergenic
1025988620 7:66477428-66477450 GTCCCCTAAAGTTTATGTGCTGG - Intergenic
1026040578 7:66865226-66865248 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
1026085379 7:67258888-67258910 ATCCCCCAAAGAGCATGTGATGG + Intergenic
1026111815 7:67464521-67464543 TCCCCCAAAAGTTCATGTATTGG + Intergenic
1026126096 7:67580938-67580960 TTCCTCCAAAATTCATGTGTTGG - Intergenic
1026336561 7:69398866-69398888 CTCCTCCAAAATTCATGTGTTGG + Intergenic
1026507217 7:70995208-70995230 ATCCCCCAGAGTTCATGTATTGG - Intergenic
1026691791 7:72556004-72556026 ATCCCCCAAAGAGCATGTGATGG - Intergenic
1026739241 7:72968529-72968551 ATCCTCCTAATTTCATGTGTTGG + Intronic
1026790271 7:73327145-73327167 ATCCTCCTAATTTCATGTGTTGG + Intronic
1027104490 7:75396544-75396566 ATCCTCCTAATTTCATGTGTTGG - Intronic
1027154839 7:75759549-75759571 GTCTCCCCAAATTCATGTGTTGG + Intergenic
1027211592 7:76153433-76153455 GTCCTCCAAAGTTTATGTGCTGG - Intergenic
1027331581 7:77101342-77101364 TCCCACAAAAGTTCATGTGTTGG + Intergenic
1027418198 7:77994616-77994638 GTCCCCCTAAATTCATGTGTCGG - Intergenic
1027886960 7:83920741-83920763 GACCCCTCAAGTTCATGTGTTGG - Intergenic
1028514479 7:91661071-91661093 TCCTCCAAAAGTTCATGTGTTGG - Intergenic
1028700672 7:93775237-93775259 ATCTCACAGAGTTCATGTGTGGG + Intronic
1028922595 7:96323694-96323716 GCCCCCCAAAATTGATGTGTTGG + Intergenic
1028994299 7:97083434-97083456 TCCCCCAAAAGTTCATGTGTTGG + Intergenic
1029162985 7:98566044-98566066 GTCCCCCAAAAAGCATGTGTTGG + Intergenic
1029514060 7:101015082-101015104 GTCCCTTAGAGTTCATGTGTTGG - Intronic
1029784191 7:102769998-102770020 TCCCACAAAAGTTCATGTGTTGG - Intronic
1029882150 7:103825915-103825937 GTACCTCAAAGTTCGTGTGTTGG + Intronic
1029914749 7:104197874-104197896 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1029941491 7:104484958-104484980 GTCCCCCAAAGTTCATGTGTTGG - Intronic
1029972389 7:104802096-104802118 TTTCCCCAAAATTCATATGTTGG + Intronic
1030040480 7:105445535-105445557 GTCCCCCAAAATTCATGTATTGG - Intronic
1030172001 7:106612396-106612418 GTCCCCCAAAGCTCATGTATGGG + Intergenic
1030254479 7:107492964-107492986 GTCCCCCAAAATTCATATGCTGG + Intronic
1030277957 7:107740087-107740109 TTCCTCCAAAATTCATATGTTGG - Intergenic
1030338527 7:108351053-108351075 GTTCCCCAAAGTTCATGTGTTGG + Intronic
1030356686 7:108551228-108551250 GTCTCCCAAAATGCATGTGTTGG + Intronic
1030359784 7:108582766-108582788 GTCTCCCAAAGTTCGTATGTTGG - Intergenic
1030362831 7:108612703-108612725 CATCCCCAAAGTTCATGTGTTGG - Intergenic
1030446147 7:109648197-109648219 GTCCCCTAAAGTTCACCTGTTGG - Intergenic
1030518965 7:110573392-110573414 CCCCTCCAAAGTTCATGAGTTGG - Intergenic
1030601842 7:111601956-111601978 GTCCCCCAAAGTGCATGTGTTGG - Intergenic
1030680349 7:112427311-112427333 TTCCCCCAAAGTTCATGTGTTGG - Intronic
1030874822 7:114800694-114800716 GTCCCCCAAAATGCATATGTTGG - Intergenic
1030929941 7:115510123-115510145 GTCCCCTAAAATTCATGTGTTGG - Intergenic
1031035948 7:116787706-116787728 GTCCCCCAAAGTTCATGTGTTGG - Intronic
1031147075 7:118008275-118008297 CTCCTGCAAAATTCATGTGTTGG - Intergenic
1031161896 7:118178910-118178932 GTCCTCCAAAATTCATATGTTGG + Intergenic
1031332443 7:120482492-120482514 GTCCTCCAAATTTCATGTGTTGG + Intronic
1031418124 7:121517609-121517631 GTCCCCCAAACTTCATGTGTTGG - Intergenic
1031549684 7:123093266-123093288 ATCCCCCAAAAAGCATGTGTTGG + Intergenic
1032010076 7:128340183-128340205 GTCCCCCAAATTTCATGTGTTGG + Intronic
1032158521 7:129491215-129491237 GTCTCCCAAAGTTTGTGTGTTGG - Intergenic
1032230211 7:130067755-130067777 GTCCCCCACAGTTCATGTGTTGG - Intergenic
1032447719 7:131999053-131999075 AGCCCCCAAAGCCCTTGTGTGGG + Intergenic
1032687555 7:134251106-134251128 ATTCCCCCAATTTCATATGTTGG + Intronic
1032823478 7:135546213-135546235 GTTCCCCAAAGTTCATGTGTTGG - Intergenic
1033059953 7:138096540-138096562 GTCCCCCCTAATTCATGTGTTGG - Intronic
1033195980 7:139327673-139327695 ATTCCCCAAAGTTCATATGTTGG - Intergenic
1033215791 7:139492650-139492672 ATTCACCAGAATTCATGTGTTGG - Intergenic
1033435218 7:141327622-141327644 GTCCCAGAAAGTTTATGTGTTGG + Intronic
1033737965 7:144243539-144243561 GTCCCCCAAAGTTCATGAGTTGG + Intergenic
1033745090 7:144307418-144307440 GTCCCCCAAAGTTCATGAGTTGG - Intergenic
1033790153 7:144782719-144782741 GTCCCCCAAAATCCGTGTGTTGG - Intronic
1033818883 7:145109523-145109545 GTCCCCCAAAAAGCATGTGTTGG + Intergenic
1033971731 7:147049189-147049211 GTCCTTCAAAGTTCATGTTTTGG - Intronic
1034055843 7:148034309-148034331 TCCCCCCAAAGTGCATGTGTTGG + Intronic
1034082123 7:148288530-148288552 GTCCCCCAAATTTCATGTGTTGG - Intronic
1034341116 7:150356144-150356166 GTCCTCTAAAGTTCATGTGTTGG + Intergenic
1034472909 7:151265113-151265135 GTCCCCCAAAATTCATATGTTGG + Intronic
1034499877 7:151442876-151442898 GTCCCCCAAAACACATGTGTTGG + Intergenic
1034512693 7:151549332-151549354 GTCCCCTGAAGTTCATGAGTTGG + Intergenic
1034686833 7:152979274-152979296 TTCCTCCAAAATTCATATGTTGG - Intergenic
1034716853 7:153251550-153251572 ATCCCCCAAAACTGATGTGCTGG + Intergenic
1034930603 7:155158674-155158696 GTCCCCCAAGTCTCATGTGTTGG - Intergenic
1034947672 7:155273875-155273897 GTCTCCCAAAGCTCATATGTTGG - Intergenic
1035554773 8:558495-558517 GTCTCCCAAAGTTCCTGTGTTGG - Intergenic
1035725254 8:1820808-1820830 TTTCCCCAAAGTTTATGTGTTGG + Intergenic
1036917675 8:12820377-12820399 GTCCCCTAAAATTCATGTGTTGG - Intergenic
1037215760 8:16449127-16449149 GTCCCCCAGAATTCATGTGTTGG - Intronic
1037545729 8:19919987-19920009 TTCCCCCAAAGTCCATGCATTGG + Intronic
1037762988 8:21754420-21754442 ATCCCCCAAGTTTCAGGTCTGGG - Intronic
1037972877 8:23186821-23186843 TGCCCCCAAAGTTCATGTGTTGG + Intergenic
1038003702 8:23412136-23412158 GTCCGCCAGAGTTCATGTGTTGG - Intronic
1038161657 8:25045315-25045337 GTCCCCCAGAATCCATGTGTTGG - Intergenic
1038523001 8:28249262-28249284 AACCCCCAAAGCAAATGTGTAGG + Intergenic
1038556596 8:28523775-28523797 GTCCCCCAAAGTTCATGTATTGG + Intronic
1038725265 8:30076588-30076610 GTCCCCCAAAGTTCACATGTTGG + Intronic
1038726266 8:30085025-30085047 GTCCCCCAAAGCTCATGTGTTGG + Intergenic
1038984844 8:32797370-32797392 GTTCCCCAAAGTTCATGTGCCGG + Intergenic
1039090180 8:33819565-33819587 TCCCCCAAAAGTTCATGTGTTGG - Intergenic
1039134685 8:34308342-34308364 GTCCCCCAAAGCTCATGTGTTGG + Intergenic
1039185394 8:34910220-34910242 TTCCCCCAAAATGCATCTGTGGG - Intergenic
1039399727 8:37259589-37259611 AGCCCCCAAAGTTGTTCTGTAGG - Intergenic
1039625993 8:39053889-39053911 CTTCCCCAAAACTCATGTGTTGG + Intronic
1039728506 8:40249218-40249240 ATCCCCCAAAGAGCATGTGGTGG - Intergenic
1039853791 8:41395434-41395456 GTCCCCCAAAGTTCAAGTGTTGG - Intergenic
1040016580 8:42705351-42705373 GTTCCCCAAAGTTCAAGTGCTGG + Intronic
1040439553 8:47426886-47426908 GTCCCCCAAAGTTAATGTGCTGG - Intronic
1040500669 8:48002204-48002226 GTCCCCCAAAGATCAAGTGTGGG - Intergenic
1040824419 8:51605680-51605702 TCCCCCAAAAGTTCATGTGTTGG + Intronic
1040885796 8:52262289-52262311 CACCCCAAAAGTTTATGTGTTGG - Intronic
1041159775 8:55027776-55027798 GCCCCTCAAAATTCATGTGTTGG + Intergenic
1041181823 8:55257105-55257127 TTCCCCCAAAATTCCTATGTTGG - Intronic
1041824423 8:62077069-62077091 ATCCCCTAAGTTTCATGTGATGG - Intergenic
1041828658 8:62127153-62127175 GTCCCCCAAACTTAATGTGTTGG - Intergenic
1042063150 8:64843489-64843511 GTCCCCCAAAGCTCATGTGCTGG + Intergenic
1042076546 8:65001490-65001512 TGACCCCAAAGTTCATGTGTTGG - Intergenic
1042114972 8:65421121-65421143 GTCCCCCAAAGTTCACATGTTGG - Intergenic
1042197026 8:66239531-66239553 TATCCCCCAAGTTCATGTGTTGG - Intergenic
1042248025 8:66727490-66727512 GTCTCCCACAGTGCATGTGTTGG + Intronic
1042653649 8:71070600-71070622 GTTCCCCAAAGTTCATATGATGG + Intergenic
1042935449 8:74053725-74053747 GTCTGCCAAATTTCATGTGTTGG + Intergenic
1043008073 8:74845429-74845451 ATCCCCAAACATTCATGTTTTGG - Exonic
1043056892 8:75450708-75450730 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1043202697 8:77390806-77390828 GTTCCCCAAATTTCTTGTGTTGG + Intergenic
1043244977 8:77987056-77987078 GTCCCCCAAAGTGCATGTATTGG - Intergenic
1043469451 8:80547806-80547828 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1043480570 8:80648203-80648225 GTCCCCCAAAGTTCATGTGTTGG - Intronic
1043543448 8:81288895-81288917 GTCCGCCAAAGTTCATGTGCTGG - Intergenic
1043624721 8:82242710-82242732 GCCCCTCCAAGTTCATGTGTTGG + Intergenic
1043624956 8:82244745-82244767 GTCCACCAAAGTTCATGTGTTGG + Intergenic
1044554836 8:93551851-93551873 CATCCCCAAAGTTTATGTGTTGG - Intergenic
1044684604 8:94814825-94814847 CTCCTCCAAAATTAATGTGTTGG + Intronic
1044755232 8:95454555-95454577 GTTCCCCAAATTTCATGTGTCGG - Intergenic
1044925714 8:97207058-97207080 GTTCCCCAAAGTTCATGTGTTGG - Intergenic
1045046717 8:98285939-98285961 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1045289703 8:100822258-100822280 GTCCTTCAAAGTTCATGTGCTGG + Intergenic
1045380569 8:101620278-101620300 TACCCCCAAAATTCATATGTTGG - Intronic
1045636225 8:104194240-104194262 TGGCCCCAAAATTCATGTGTTGG + Intronic
1045683257 8:104685103-104685125 TTTTCCCAAAGTTCATGTATTGG - Intronic
1045765711 8:105665307-105665329 TCCCCCAAAAGTTCATTTGTTGG - Intronic
1045817508 8:106293893-106293915 GTCCCCCAAAATTCATTTGTTGG - Intronic
1045830915 8:106459132-106459154 AGCCCCCAAAGTTCATGTGTTGG + Intronic
1046378670 8:113422307-113422329 AAACCCCAAATTTAATGTGTAGG - Intronic
1046381537 8:113456652-113456674 ATCTCTTAAAATTCATGTGTTGG - Intergenic
1046581440 8:116097969-116097991 GTCTCCCAAAGTTCATGTGTTGG + Intergenic
1046646842 8:116794517-116794539 ATCCCACAATGTTTAAGTGTTGG - Intronic
1046862793 8:119113405-119113427 ATCCTTTAAAATTCATGTGTTGG + Intergenic
1047006480 8:120625211-120625233 GTCCCCCAGTGTTCATGTGTTGG - Intronic
1047151427 8:122267648-122267670 GTTCCCCAAAGTTCATCTGTTGG - Intergenic
1047250572 8:123179177-123179199 GTCTCCTAAAGTTCATGTGTTGG + Exonic
1047425591 8:124742600-124742622 GTTCCCCAAAGTTCATGTTTTGG - Intergenic
1047491984 8:125382648-125382670 ATCCCCCAAATTTCATGTGTTGG - Intergenic
1047568314 8:126070761-126070783 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1047799358 8:128292832-128292854 ATACCCCAAATTTCATGTGTTGG - Intergenic
1047913942 8:129561483-129561505 GCCTTCCAAAGTTCATGTGTTGG + Intergenic
1048476734 8:134749583-134749605 TCCCCCCAAAATTCATATGTTGG - Intergenic
1048498057 8:134951728-134951750 GTCCCCCCAAATTCATGTGGTGG + Intergenic
1048601894 8:135927455-135927477 GTTCCCCAAAGTTTATGTGTTGG + Intergenic
1048699818 8:137076268-137076290 TGCCCCCAAAATTCATGTGTTGG + Intergenic
1048735763 8:137499937-137499959 GTTCCCCAAAGTTCAGGTATTGG + Intergenic
1048840373 8:138560432-138560454 GTCCCTCAAAGTTCATGTGTTGG - Intergenic
1048885740 8:138907959-138907981 TCTCCCCAAAGTTCATGTGTTGG - Intronic
1049498719 8:142949563-142949585 GTCCCTCAAAGTTCATGTGTTGG + Intergenic
1050352274 9:4751557-4751579 GTCCTCCTAATTTCATGTGTTGG - Intergenic
1050415492 9:5412366-5412388 TCCCCCCAAAGTTCATGTGTGGG + Intronic
1050463709 9:5898499-5898521 GTCCCCCAAAATTCGTGTATTGG - Intronic
1050487369 9:6148379-6148401 ATCCCTCAAATTTCATGTGTTGG + Intergenic
1050664928 9:7925024-7925046 ATGTACCAAAGTTCATTTGTTGG - Intergenic
1050770267 9:9190073-9190095 GTCCTCCAAAGTTCATGTGTTGG + Intronic
1050802795 9:9637126-9637148 GTCCCCCACAATTCATGTGTTGG - Intronic
1051029011 9:12651711-12651733 GTCCCTGAAAATTCATGTGTTGG + Intergenic
1051306579 9:15716875-15716897 GTCCTCCAAAGTTCACGTGTTGG - Intronic
1051668029 9:19483758-19483780 ATCCCCCAAGTTTCATGTGTTGG + Intergenic
1051742047 9:20261596-20261618 ATCCCCCAAAATTCACGTGTTGG - Intergenic
1051873552 9:21767032-21767054 ATCCCCCAAAAAGCATGTGCTGG - Intergenic
1052140659 9:24978466-24978488 ATCCCCCCAGATTCATGTATTGG - Intergenic
1052182522 9:25547164-25547186 GTCCCCCAAATTTCATGTGTTGG + Intergenic
1052300064 9:26943997-26944019 GTCCCCCAAAGTTCATGTGCTGG + Intronic
1052464765 9:28816231-28816253 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1052648575 9:31271136-31271158 ATTCCCCAAACAGCATGTGTTGG + Intergenic
1052679666 9:31673133-31673155 TCCCTCCAAAATTCATGTGTTGG - Intergenic
1052680832 9:31690374-31690396 ATTCCCCGAAGTTCATGTGTTGG + Intergenic
1052782239 9:32793596-32793618 ATCCCCAAAAGTTCATGCATTGG + Intergenic
1053027709 9:34744109-34744131 GCCTCCCAAAGTTCATGTGTTGG - Intergenic
1053034361 9:34811286-34811308 GTCTCCCAAAGTTCATGTGTTGG + Intergenic
1053450645 9:38191579-38191601 GTACCCCAAAGTTCATGTGTTGG - Intergenic
1053459686 9:38258603-38258625 GTCCCCCAAAATTCGTGTGTTGG - Intergenic
1054806620 9:69401911-69401933 GTTCCCCAGAATTCATGTGTTGG - Intergenic
1054884241 9:70178486-70178508 ATCCCCCAAAACTCATGAGTTGG - Intronic
1054968990 9:71062616-71062638 ATCCCACAAAATTCATGTGTAGG + Intronic
1055054993 9:72015248-72015270 TTCCCCCAAAATTCATATGTTGG - Intergenic
1055388686 9:75794717-75794739 TTCCCCCAAAGTTCATGGGTTGG - Intergenic
1055450099 9:76423219-76423241 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1056033587 9:82580445-82580467 GTCCCCCAAAATTCATGTGTTGG - Intergenic
1056290257 9:85135892-85135914 ATCCCCAAAAGTTTATGTGTTGG - Intergenic
1056594674 9:87997332-87997354 GTCCCCCCAAATTCATGTGTTGG + Intergenic
1056635822 9:88330450-88330472 GTTCCCCAAAATTTATGTGTTGG - Intergenic
1056746238 9:89306350-89306372 GTCCCCCAAATTTCACGTGTTGG + Intergenic
1056854034 9:90109498-90109520 TTCCCCAAAAGCTCATGTGTTGG - Intergenic
1057330742 9:94112654-94112676 ATCCCTCAAAATTCATGTGTTGG + Intergenic
1057364229 9:94403878-94403900 GTCTCCCAAAATTCATGTGTTGG + Intronic
1057640243 9:96812744-96812766 TCCCCCCAAAGTTCGTATGTTGG - Intergenic
1057659107 9:96984193-96984215 GTCTCCCAAAATTCATGTGTTGG - Intronic
1058255125 9:102752407-102752429 GTCTCCCAAAATTCATGTGTTGG + Intergenic
1058366228 9:104211838-104211860 GTCCCTCCAAGTTCATCTGTTGG - Intergenic
1058850000 9:109002366-109002388 TTCCCCCAAAATTTATATGTTGG - Intronic
1059266013 9:113031304-113031326 GTGCCTCAAAATTCATGTGTTGG - Intergenic
1059304550 9:113343665-113343687 GTCCCCCAAAGTTCATGTGCTGG - Intergenic
1059357764 9:113713553-113713575 GTCCCCCAAAGTTTGTATGTTGG - Intergenic
1059477134 9:114556497-114556519 GTCCCCCAAATTTCATGTGTTGG + Intergenic
1059510291 9:114839103-114839125 GCTCTCCAAAGTTCATGTGTGGG - Intergenic
1059547157 9:115188643-115188665 GTCCTTCAAAGTGCATGTGTTGG + Intronic
1059614606 9:115935293-115935315 ATCCCCCACATGTCATGGGTAGG + Intergenic
1059801614 9:117755107-117755129 ATCCCCCTAATTTCATTTGCTGG + Intergenic
1059820713 9:117969249-117969271 GTTCCCCAAAGTTTATGTGTTGG - Intergenic
1059898844 9:118899496-118899518 TTCCCCCACAGTTCACATGTTGG - Intergenic
1060119552 9:120975464-120975486 GTCCCCCAAAGTTCATGTGTTGG + Intronic
1060167253 9:121428727-121428749 GTCCCCCAAATTTCATGTGTTGG + Intergenic
1060329741 9:122656320-122656342 GTCCCCCAAAGTCCATGTGTTGG + Intergenic
1061785686 9:133026697-133026719 GTCCCCCAAATTTCATGTGTTGG - Intergenic
1062751164 9:138254786-138254808 GTCCCCCAAAGTTTATGTGCTGG + Intergenic
1185667989 X:1782830-1782852 GTCTCCCAAGCTTCATGTGTTGG - Intergenic
1185847835 X:3456422-3456444 ATCCCCTTAAATTCGTGTGTTGG + Intergenic
1186170147 X:6868056-6868078 GTTCCCCAAAGGTCATGTGTTGG - Intergenic
1186179632 X:6960219-6960241 TATCCCCAAAGTTCAGGTGTTGG + Intergenic
1186392309 X:9173374-9173396 ATCCCCCAAAATTCATAGGCTGG + Intergenic
1186602754 X:11056030-11056052 ATCTCCCAAAGTGCAGGTGCAGG - Intergenic
1186734294 X:12444890-12444912 GTTCCCCAAAGTTCATGTGTTGG - Intronic
1186738344 X:12490341-12490363 GTCCCCCAAAGTTCACATGTTGG - Intronic
1186877190 X:13828173-13828195 TATCCCCAAATTTCATGTGTTGG + Intronic
1186926850 X:14343065-14343087 GTCTCCCAAAGTTTATGTGTTGG - Intergenic
1186980584 X:14953849-14953871 GTCCCCCAAATTTCATGTGTTGG - Intergenic
1187081341 X:15992048-15992070 GTTCCCCAAAGTTTATGTATTGG + Intergenic
1187292007 X:17963561-17963583 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1187305444 X:18091305-18091327 GTCTTCCAAAGTTCATTTGTTGG + Intergenic
1187549973 X:20292836-20292858 GTCCCCCAAAGTTCCTGTGTTGG + Intergenic
1187614451 X:20977816-20977838 GTCCCCCAAAGTTCTTGTGTTGG - Intergenic
1187685363 X:21810547-21810569 GTTCCCCAAAGTTCATGTACTGG - Intergenic
1188033084 X:25285821-25285843 TGCTCCCATAGTTCATGTGTTGG - Intergenic
1188091092 X:25966792-25966814 GTTCCTCAAAGTACATGTGTTGG + Intergenic
1188228443 X:27631011-27631033 ACTCCCCAAATTTCATATGTTGG - Intronic
1188380393 X:29484448-29484470 GTTCCCCAAACTTTATGTGTTGG - Intronic
1188384020 X:29533864-29533886 TTCCCACAAAGTTCATGTTTTGG + Intronic
1188520046 X:31028973-31028995 TGTCCCCGAAGTTCATGTGTTGG + Intergenic
1188527884 X:31106001-31106023 ATCTGCCAAATTTCATGTGTTGG + Intronic
1188611311 X:32101782-32101804 GTCCCCCAAATTTCATGTGTTGG + Intronic
1188961735 X:36501296-36501318 GTCCTCCAAAGTTCATGTTTTGG + Intergenic
1189080210 X:37962940-37962962 GTCCCCAAAATTTCATGTGTTGG - Intronic
1189124793 X:38434964-38434986 TCCCTCCAAAATTCATGTGTTGG - Intronic
1189489427 X:41458208-41458230 GTCCTCCTAAGTTCACGTGTTGG - Intronic
1189706676 X:43765586-43765608 ATCCCCCAAAGTTCATGTGTTGG + Intergenic
1189717939 X:43883932-43883954 GTCCCCCAAAGTTCACGTGTTGG + Intergenic
1189729789 X:44007572-44007594 GTCCCCCAAAGTTCTTATGTTGG + Intergenic
1189973078 X:46437632-46437654 GTCTCCCAAAGTTCATGTGTTGG - Intergenic
1189973608 X:46441375-46441397 GTCCCCCAAAATTCATGTGTTGG - Intergenic
1190372400 X:49755264-49755286 CCCCCTCAAAATTCATGTGTTGG + Intergenic
1190710152 X:53062183-53062205 GTCCTCCGAAGTTCATGTGTTGG - Intronic
1190933272 X:54969129-54969151 ATCCTCCAAAGTTCATGTGTTGG + Intronic
1191696072 X:63992183-63992205 GTCTCCCAAAGATCATGTGCTGG + Intergenic
1191856597 X:65632107-65632129 GTCCCCCAAAAATCATGTGTTGG + Intronic
1192416554 X:70986190-70986212 GTCCCCAAAAGTTCATGCATTGG - Intergenic
1192658143 X:73013871-73013893 GTGCCCCAAAATTCATGTGCTGG - Intergenic
1192658658 X:73020190-73020212 GTCCTCCAAATTTCAGGTGTCGG + Intergenic
1192781227 X:74295618-74295640 GTCTCTCAAAGTTCATATGTTGG - Intergenic
1192819847 X:74633481-74633503 TGTCCCCAAAGTTCATGTGTTGG + Intergenic
1193331960 X:80244902-80244924 GTCTCCCAAAGTCCATGTGTTGG + Intergenic
1193449673 X:81650169-81650191 GTCCCTTAAATTTCATGTGTTGG + Intergenic
1193577587 X:83220926-83220948 TTCCCCCAAAATTCACATGTTGG - Intergenic
1193995242 X:88358660-88358682 GTCCCGCAGAGTCCATGTGTTGG - Intergenic
1194108352 X:89799475-89799497 GACCCCCAAATTTTATGTGTTGG + Intergenic
1194151618 X:90331699-90331721 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1194288860 X:92043442-92043464 ATACACCAAAGTTTATGTTTAGG + Intronic
1194386190 X:93257809-93257831 ACCCCACAAAGTTTATGTGTTGG - Intergenic
1194406576 X:93503502-93503524 ATCTCCCAAAGTTCATGTGTTGG - Intergenic
1194704054 X:97152799-97152821 GTCCCCCAAAGTTCATGAGTTGG - Intronic
1194762315 X:97809399-97809421 GCCCCCCAAAGTTCATGTGTTGG - Intergenic
1194829312 X:98601246-98601268 TCCCCCAAAAGTTCATGTGTTGG + Intergenic
1195167730 X:102236862-102236884 GTCCTTCAAAGTTCATGTGTTGG + Intergenic
1195191127 X:102450225-102450247 GTCCTTCAAAGTTCATGTGTTGG - Intronic
1195228831 X:102825294-102825316 GTCTTCCAAAGTTCATTTGTTGG - Intergenic
1195315103 X:103669829-103669851 GTCCCCCAAAGCTCATGTGTTGG + Intergenic
1195805925 X:108764977-108764999 GTCCTCCAAAATGCATGTGTTGG - Intergenic
1195934609 X:110112931-110112953 TCCCCCCAAAATTCATATGTTGG - Intronic
1196184276 X:112728582-112728604 ATCCTCCAAAGTTCACATGTTGG - Intergenic
1196366564 X:114930944-114930966 GTCCCCCAAAATTCATGTGTTGG - Intergenic
1196723597 X:118876895-118876917 GTCCCCTAAAGTTCATGTGTTGG + Intergenic
1196729933 X:118930583-118930605 ATCCCCCAAAATTCATGTGTTGG + Intergenic
1196743344 X:119045206-119045228 ACCCCCTAAAGTTCGTGTGTTGG - Intergenic
1196801723 X:119549845-119549867 TTCCCCAAAAGTTCATGTGTTGG - Intronic
1196896285 X:120340024-120340046 GTCCCCCACATTTTATGTGTTGG + Intergenic
1197036857 X:121883737-121883759 GTCCCCCAAAAAGCATGTGTTGG + Intergenic
1197270945 X:124424218-124424240 GTCCCCCAAATATCATGTGTTGG + Intronic
1197316652 X:124974303-124974325 GTCCTCCAAAGTTTATGTGTTGG - Intergenic
1197342488 X:125289564-125289586 GTCTCCCAATGTTGATGTGTTGG + Intergenic
1197349113 X:125360407-125360429 GTCCCCCAAAGTTCATGTTTTGG + Intergenic
1197861169 X:130972226-130972248 GTCCCCCAAAAAGCATGTGTTGG + Intergenic
1197895454 X:131308933-131308955 GTCCCCCAGAATTCATGTGTTGG + Intronic
1198078738 X:133218674-133218696 TCCTCCAAAAGTTCATGTGTTGG - Intergenic
1198455718 X:136815739-136815761 GTCCTCCAAATTTCATGTGTTGG - Intergenic
1198519946 X:137442381-137442403 GTCCCTTAAAATTCATGTGTTGG + Intergenic
1198561456 X:137854975-137854997 ATGCCCCAAAATTTGTGTGTTGG - Intergenic
1198678595 X:139157387-139157409 TCCTCCAAAAGTTCATGTGTTGG + Intronic
1198798135 X:140421395-140421417 GTCCCCCAAAATGTATGTGTTGG - Intergenic
1198979482 X:142379151-142379173 GTCCCCCAAAATTTATGTGTTGG + Intergenic
1199083202 X:143599683-143599705 TTTCTCTAAAGTTCATGTGTTGG + Intergenic
1199477851 X:148265471-148265493 GTTCCCCAGAATTCATGTGTTGG - Intergenic
1199738298 X:150706284-150706306 GTCCCCTAAATTTCATGTATTGG - Intronic
1199936241 X:152576291-152576313 GTCTCCCAAAGTTTATGTGTTGG + Intergenic
1199992620 X:152996245-152996267 GTCCCCCAGAGTTCATGTGTTGG - Intergenic
1200274782 X:154721605-154721627 GTCCTCCAAAGTTCATGTGTTGG - Intronic
1200461010 Y:3454211-3454233 GACCCCCAAATTTTATGTGTTGG + Intergenic
1200497977 Y:3908446-3908468 GTCCCCCAAAGTTCATGTGTTGG - Intergenic
1200606380 Y:5268009-5268031 ATACACCAAAGTTTATGTTTAGG + Intronic
1200698973 Y:6386102-6386124 ATCCCCTAAAGTGCAGGTCTAGG - Intergenic
1200815975 Y:7532716-7532738 ATCCCCATAAATTCGTGTGTTGG - Intergenic
1200842300 Y:7795229-7795251 TCTCCCCAAAATTCATGTGTTGG + Intergenic
1201035139 Y:9778597-9778619 ATCCCCTAAAGTGCAGGTCTAGG + Intergenic
1201070508 Y:10143671-10143693 GTCCCCCAGAGCTCAAGTGTTGG + Intergenic
1201148425 Y:11080130-11080152 GTTCCTCAAATTTCATGTGTTGG - Intergenic
1201187903 Y:11421648-11421670 GTCCCCCGAAGTTCATGTGTTGG - Intergenic