ID: 1020431247

View in Genome Browser
Species Human (GRCh38)
Location 7:8118589-8118611
Sequence ATTTGGGTCTAGAAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020431247_1020431253 17 Left 1020431247 7:8118589-8118611 CCATTTTCCTTCTAGACCCAAAT 0: 1
1: 0
2: 3
3: 25
4: 324
Right 1020431253 7:8118629-8118651 AATGTGGAAAGTTAAAGTTGTGG 0: 1
1: 1
2: 5
3: 48
4: 389
1020431247_1020431252 1 Left 1020431247 7:8118589-8118611 CCATTTTCCTTCTAGACCCAAAT 0: 1
1: 0
2: 3
3: 25
4: 324
Right 1020431252 7:8118613-8118635 ACATAAAACAGTGGTAAATGTGG 0: 1
1: 0
2: 0
3: 25
4: 293
1020431247_1020431249 -8 Left 1020431247 7:8118589-8118611 CCATTTTCCTTCTAGACCCAAAT 0: 1
1: 0
2: 3
3: 25
4: 324
Right 1020431249 7:8118604-8118626 ACCCAAATCACATAAAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020431247 Original CRISPR ATTTGGGTCTAGAAGGAAAA TGG (reversed) Intronic
901904389 1:12395072-12395094 CTTTAGGTCTAGAAGCAAACAGG + Intronic
902168768 1:14594061-14594083 ATTTGGTCCTAGAAGGCAATGGG - Intergenic
902338748 1:15768797-15768819 ATTTAGGTATAAAGGGAAAAAGG - Intronic
903554767 1:24185554-24185576 TTTTGGGTCTAGAAGGTGATGGG - Intronic
904442076 1:30538565-30538587 AGTTGTGGATAGAAGGAAAAAGG + Intergenic
905112240 1:35604240-35604262 CTTTGGGTATAGATGGAGAATGG - Intronic
905353757 1:37366369-37366391 TTTTAGGTCTAGAAGCAAACAGG - Intergenic
905933940 1:41808719-41808741 ATTTGGGGGTAGAAGTGAAATGG + Intronic
906995300 1:50787073-50787095 ATGTGGTTCTACAATGAAAATGG + Intronic
909875346 1:80795846-80795868 ATTTAGGTCTTGAAGGCAAGAGG - Intergenic
911980157 1:104557260-104557282 TTATAGGTCTAGAAGGAAACAGG - Intergenic
912071016 1:105809801-105809823 TTATGGGTCTAGAAGCAAAAAGG + Intergenic
912177734 1:107181142-107181164 ATCTGGGACTAGCAGAAAAAGGG + Intronic
912944138 1:114070581-114070603 TTATGGGTTTAGAAGGAAACAGG + Intergenic
913336255 1:117711111-117711133 ATTTGGTTATAAAAGGAAATGGG + Intergenic
913432713 1:118812940-118812962 AGTTGGTTCTGGAAGGAAAATGG - Intergenic
913668219 1:121070114-121070136 TTCAGGGTCTAAAAGGAAAATGG - Intergenic
914019963 1:143857556-143857578 TTCAGGGTCTAAAAGGAAAATGG - Intergenic
914658462 1:149765470-149765492 TTCAGGGTCTAAAAGGAAAATGG - Intergenic
916317131 1:163461685-163461707 TTTGGGGTCAAGAAGTAAAAGGG + Intergenic
920355971 1:205372919-205372941 ATTTGTCTCTTGAAGGAGAATGG - Intergenic
920648226 1:207818526-207818548 ATTTGGGTCAATATGGAAAGGGG + Intergenic
922364742 1:224853289-224853311 AGTTGGGTCTTGAAATAAAATGG + Intergenic
923493298 1:234503363-234503385 ATTAGGGTCAGAAAGGAAAAGGG + Intergenic
1064132573 10:12722984-12723006 ATTTGAGTGTAGATGGGAAAAGG + Intronic
1066250277 10:33626347-33626369 ATTTGGGACTTGAAGGAATATGG + Intergenic
1069078271 10:64061588-64061610 ATTAGGTTCAAGAAGGCAAATGG + Intergenic
1071166034 10:82807929-82807951 ATTTAGGTAAAGAAAGAAAAAGG - Intronic
1072866238 10:99065310-99065332 AACTGGGTGCAGAAGGAAAATGG - Intronic
1073251188 10:102121060-102121082 AGTTGGGACTAGAACTAAAAGGG + Intergenic
1073509507 10:104034476-104034498 ATTTTGGTGTGGAAGGAAACCGG + Intronic
1074006288 10:109427781-109427803 ATTTGGGTGGAGAGGGAACAGGG + Intergenic
1074920164 10:118000341-118000363 AGTTGGGTGGAGAAGGGAAACGG - Intergenic
1075353534 10:121747949-121747971 AAATGTGTCTAGCAGGAAAAAGG + Intronic
1076100543 10:127774267-127774289 ATTTGGGGTTAGAAGGCAATAGG - Intergenic
1078473656 11:11611918-11611940 ATTTGTGTCTACAAGGAACCTGG - Intronic
1078859522 11:15234304-15234326 ATATGTGTTTAGAAGGAAAGGGG + Intronic
1080905655 11:36542394-36542416 CTTTGTGTGTAGAAGGAAAGAGG - Intronic
1082260001 11:50071504-50071526 ATTTGGGCCTACGAGGCAAAAGG + Intergenic
1082294981 11:50429602-50429624 ATTTTGGTCTAGTGTGAAAAAGG + Intergenic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1087034733 11:93743823-93743845 AATAGGGTCTAGAAGGGAAACGG - Intronic
1087143992 11:94793878-94793900 ATTTTGGACTAGAAAGAGAAAGG - Intronic
1087943993 11:104135999-104136021 ATTGGAGTCTGGAAGGAGAAAGG + Intronic
1088355292 11:108937095-108937117 AGATGGGTCTTGAAGGACAAGGG + Intronic
1088600984 11:111475093-111475115 TTTTAGATCTAGAAAGAAAATGG + Intronic
1091212155 11:133871315-133871337 TTATAGGTCTAGAAGAAAAAAGG - Intergenic
1091878927 12:3960654-3960676 ATTGGGGTGCAGAAGGAAATAGG - Intergenic
1093077080 12:14769836-14769858 CTGGGGGTCTAGAAGGGAAACGG - Intronic
1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG + Intergenic
1093773797 12:23048835-23048857 ATTTGGATCTGCAAGAAAAAAGG - Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1095078879 12:37971769-37971791 ATTGGGGTCTATAATGAAAAAGG + Intergenic
1095543534 12:43339520-43339542 AATTGGGTCTAGAATGGGAAAGG - Intergenic
1096537249 12:52283058-52283080 ATTAGGGGCTAGAGGGAAATGGG - Intronic
1096635081 12:52953017-52953039 ATTGGGGTGTAGAAGGAAGAGGG + Intergenic
1096932471 12:55228145-55228167 ATTTGGATCCAGAAGGTAAGTGG - Intergenic
1097242912 12:57588472-57588494 ATGTGGGGATTGAAGGAAAAGGG - Intergenic
1098175737 12:67788855-67788877 CTTTGAGGCTAGAAGGAAAAAGG + Intergenic
1098350816 12:69558131-69558153 TTCTGGGTCTAGAAGGGAAGAGG + Intronic
1098677087 12:73303356-73303378 ATTTCCTCCTAGAAGGAAAATGG + Intergenic
1099508970 12:83509925-83509947 TTTTGCTTCTAGAAGGCAAAGGG + Intergenic
1099865063 12:88269657-88269679 ATTTGGAACCAGAAGGAAAAGGG + Intergenic
1100715906 12:97305143-97305165 AGTTGGCTGTAGAGGGAAAAAGG + Intergenic
1101401984 12:104396414-104396436 ATTTGGGTGCAGAAGGCAGATGG - Intergenic
1101841194 12:108328611-108328633 ATTTAGGTCATGAAGAAAAAGGG - Intronic
1103727208 12:123003910-123003932 TTTTGGGACTAGTGGGAAAATGG + Intronic
1104070872 12:125344407-125344429 CTTTTGGGCTAGAGGGAAAAGGG + Intronic
1104158199 12:126153452-126153474 ATCTGGGAAGAGAAGGAAAATGG + Intergenic
1104368813 12:128203977-128203999 TTTTAGCTCTAAAAGGAAAATGG + Intergenic
1106870762 13:34017228-34017250 ATATGGTTCCAGAGGGAAAACGG - Intergenic
1107048367 13:36019358-36019380 ATTTGGGGCTAGAAGGAGAAAGG - Intronic
1107809799 13:44189375-44189397 AGTTGGGTCTTGCAGGATAAGGG - Intergenic
1108444577 13:50494533-50494555 ATTTGGGTTTAGAAAGATTAAGG + Intronic
1109392068 13:61706464-61706486 TTTTAGGTCTAGAAGCAAAGAGG - Intergenic
1109588230 13:64438662-64438684 ATATGTGTAAAGAAGGAAAAAGG - Intergenic
1111432489 13:88162020-88162042 TTATAGGTCTAGAAGCAAAAAGG + Intergenic
1111549588 13:89789361-89789383 CTATGGGACTACAAGGAAAACGG + Intergenic
1113011439 13:105771992-105772014 AGTTGGCTATAGCAGGAAAATGG + Intergenic
1113320029 13:109224103-109224125 TTATAGGTCTAGAAGCAAAAAGG + Intergenic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1114922151 14:27345043-27345065 ATTTGGTTCTACGAGTAAAATGG + Intergenic
1115456440 14:33609450-33609472 ATTTGGGTTGAAAAGGAAAAAGG - Intronic
1116251388 14:42487429-42487451 AGATGGGTAAAGAAGGAAAAAGG + Intergenic
1116453917 14:45095849-45095871 AATTGCGTTTAGAAGAAAAAGGG + Intronic
1116781481 14:49241844-49241866 ATTTAATTCAAGAAGGAAAATGG - Intergenic
1117672584 14:58123547-58123569 AGCTGGGTCTAGAGGGACAACGG - Intronic
1118318429 14:64739303-64739325 CAATGGCTCTAGAAGGAAAAGGG + Intronic
1119568634 14:75650227-75650249 ATTTTGGTCAAGAAGGAATGTGG - Exonic
1120453808 14:84705453-84705475 ATCTGGGTCTAGAATAAAACTGG + Intergenic
1120556311 14:85932853-85932875 TTATAGGTCTAGAAGGAAACAGG + Intergenic
1121984799 14:98494628-98494650 AATTGGTTCTAGAAGGACACAGG - Intergenic
1122042016 14:98994921-98994943 ATTTCGTTCTAGAAGAAAACAGG + Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122749069 14:103919559-103919581 ATGAGGGTCTATAAGGAAAAGGG + Intronic
1123925608 15:25107279-25107301 ATTTTGGTCTCGAAGGCCAAAGG - Intergenic
1126206885 15:46056292-46056314 ACGTGGGTCAAGAAGGAAATAGG - Intergenic
1126397575 15:48235297-48235319 ATTTGGGTTTAAAAGAGAAAGGG - Intronic
1126884403 15:53134183-53134205 ATTTTGGTTCAGAAAGAAAATGG + Intergenic
1127941696 15:63704505-63704527 ATTTGGCGCTAGAGAGAAAATGG - Intronic
1128665392 15:69533782-69533804 ATTTAAGTATGGAAGGAAAAGGG - Intergenic
1128921130 15:71611342-71611364 ATCTCTTTCTAGAAGGAAAATGG - Intronic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1131158002 15:90086797-90086819 CTTTGGTTCCAGTAGGAAAATGG - Intronic
1132297643 15:100753197-100753219 TTTGGGGACTAGAAGGGAAAGGG + Intergenic
1132347307 15:101116098-101116120 ATTTGGGGCTGGAAAGAAAATGG + Intergenic
1134364254 16:13562129-13562151 ATTAGGTGCTGGAAGGAAAAAGG - Intergenic
1135062013 16:19279162-19279184 TTATAGGTCTAGAAGTAAAAAGG + Intergenic
1135408081 16:22212649-22212671 ATTTGTTTTTAAAAGGAAAAGGG + Intronic
1137250345 16:46736644-46736666 ACTTGGTTCTAGGAGGAAATGGG - Intronic
1138949128 16:61889315-61889337 ATTTGGGTCTAAAAATCAAATGG + Intronic
1139215600 16:65122448-65122470 ATTTGGGGGAAGGAGGAAAATGG - Intronic
1139765063 16:69221246-69221268 ATTTAGGTTTAGAAGGAAGTGGG - Intronic
1139777023 16:69322756-69322778 GTTTGGGTCCAGAATAAAAACGG + Intronic
1140420968 16:74818328-74818350 TTTTTGGTTTAGAAGGAACAGGG - Intergenic
1141125964 16:81401369-81401391 ATTTGGGTCTAGCAAGGATAGGG - Intergenic
1141198033 16:81876348-81876370 ATTTGGTTCTGGAAGGCCAAGGG - Intronic
1142219104 16:88844380-88844402 ACTTTGCTCTAGAAGGAGAAGGG + Intronic
1142652230 17:1362137-1362159 TTTTGTGTCAAGAAGGAAGAAGG - Intronic
1143338839 17:6193828-6193850 ATTTAGGGCAAGAAAGAAAATGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146618857 17:34380456-34380478 TTTTGGGACAAGAGGGAAAAGGG - Intergenic
1146722930 17:35136073-35136095 AGCTGGGTCTAGAAGGGAGAAGG + Intronic
1148566767 17:48637521-48637543 ATTTGGGCCAAGAAGGAGAGTGG - Intergenic
1149069949 17:52528554-52528576 ATTTGTGTGTAGAAAGTAAAAGG - Intergenic
1149413856 17:56437613-56437635 ATTTAGCTATAGAAGAAAAACGG - Intronic
1149439432 17:56662482-56662504 ATTTGTGTCTATTAGGAAAAGGG - Intergenic
1149743960 17:59076663-59076685 TTTTGGGTTTACAAAGAAAATGG - Intronic
1150501686 17:65657201-65657223 ATTTGGTTTTAGAAGAAAAGAGG - Intronic
1150819478 17:68423729-68423751 ATTTGGGGTAAAAAGGAAAAGGG - Intronic
1151136520 17:71951095-71951117 ATTTTGTTTTGGAAGGAAAAGGG + Intergenic
1151252075 17:72843939-72843961 TTTTTGGAGTAGAAGGAAAATGG - Intronic
1152991023 18:363589-363611 ATTTGGCTCTAACAGTAAAACGG + Intronic
1153150159 18:2083572-2083594 CTTTGGGGCTAGATGGAAATAGG - Intergenic
1154393177 18:13960974-13960996 ATTAGGTTCTATAAGCAAAATGG + Intergenic
1155505997 18:26533354-26533376 ATTTCAGTCAAGTAGGAAAAGGG + Intronic
1156886296 18:42140167-42140189 ATTTGATTAAAGAAGGAAAATGG + Intergenic
1159919692 18:74216364-74216386 ATCCTGGGCTAGAAGGAAAAAGG + Intergenic
1160759815 19:777920-777942 ATCTGGGGCTAAAAGGAGAAGGG - Intergenic
1161537867 19:4831254-4831276 ATTTGGGGTGAGAAGGAATATGG + Intronic
1164491752 19:28721006-28721028 ATTTGGGTGTAAAAGGTGAAAGG - Intergenic
1164742544 19:30587099-30587121 TTGAGGATCTAGAAGGAAAAAGG - Intronic
1164903476 19:31947789-31947811 TTTTGGCTCTAGAAGAGAAAGGG + Intergenic
1166813229 19:45526572-45526594 ATTTGGGTTTTGGGGGAAAAGGG + Exonic
1167267917 19:48492795-48492817 GTGTGGGTCTGGAAGGAAAGAGG - Intronic
926402999 2:12518878-12518900 ATTTGGGTCAAAAGGGAAAGTGG - Intergenic
929708088 2:44237296-44237318 ATTATGGTCTAGAAGTAAATAGG + Intronic
930593958 2:53363166-53363188 ATATGGGTCTTAAAGGATAAGGG + Intergenic
930624268 2:53679168-53679190 ATTGGGGTGCAGAAGCAAAATGG - Intronic
931493618 2:62777827-62777849 AGTTTAGTCTTGAAGGAAAAAGG + Intronic
931609422 2:64082407-64082429 ATCAGGGACTTGAAGGAAAAGGG - Intergenic
931937016 2:67210120-67210142 ATTTGGGTCTATCAGGGAACTGG + Intergenic
932176184 2:69604853-69604875 TTTAGAGTCTAGAAGGAGAAAGG - Intronic
932294030 2:70609437-70609459 CCTTGGGACAAGAAGGAAAAAGG + Intronic
932448208 2:71793566-71793588 ATTTGTGTCAAGAAAGAAAGGGG - Intergenic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933916289 2:86997222-86997244 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
934006704 2:87772683-87772705 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935770351 2:106413604-106413626 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935967860 2:108499212-108499234 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936131519 2:109847469-109847491 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936213178 2:110524016-110524038 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936422317 2:112378573-112378595 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936640972 2:114312600-114312622 TTTTAGGTCTAGAAGCAAACAGG - Intergenic
937036669 2:118787814-118787836 ACTCTGGTCTTGAAGGAAAAAGG + Intergenic
937663858 2:124462322-124462344 ATTTAAAACTAGAAGGAAAATGG - Intronic
937710723 2:124977435-124977457 ATTCAGGGTTAGAAGGAAAAAGG - Intergenic
937814435 2:126235808-126235830 ACTTGGCTTTAGAAGGAAAAGGG - Intergenic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
940937370 2:159512295-159512317 ATTTCGATCCAGAAGGCAAAAGG + Intronic
941278566 2:163521367-163521389 ATTTATATTTAGAAGGAAAATGG + Intergenic
942279002 2:174342438-174342460 ATTTGGGTTTCAAAGGGAAAAGG - Intergenic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
944048963 2:195444920-195444942 ATTGGGCTCTAGCAGTAAAAGGG + Intergenic
945046843 2:205789294-205789316 ATGGGGGCCTAGAAGGAAACAGG + Intronic
945483080 2:210364853-210364875 ATTTAATTCAAGAAGGAAAATGG - Intergenic
946158006 2:217819716-217819738 ATTTGGGTCTAGAAGGAGTCAGG - Intronic
948034759 2:234849022-234849044 ATCTGGGTCTCTATGGAAAAGGG - Intergenic
948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG + Intergenic
1168971375 20:1933298-1933320 AGTTGAGTCTTGAAGGAAACAGG + Intronic
1171496339 20:25558597-25558619 AAGTTGGTCAAGAAGGAAAAAGG - Intronic
1173584528 20:44172261-44172283 AATTGGGGTGAGAAGGAAAAAGG + Intronic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1174800652 20:53560550-53560572 ATTTGGCCCTGGAGGGAAAAGGG - Intergenic
1174920848 20:54700377-54700399 ATCTGGGGCCAGAAGGCAAATGG + Intergenic
1177436438 21:21059903-21059925 ATTCTGGTCTAGAAGTTAAAGGG + Intronic
1178295290 21:31404904-31404926 ATTAGGATCTAGGAGGAACAGGG - Intronic
1178343486 21:31805689-31805711 AATGGGGTCTGGAAGGACAAGGG + Intergenic
1178681796 21:34678526-34678548 AGTTCGATTTAGAAGGAAAAAGG + Intronic
1181182124 22:21075699-21075721 ATTTGTGTTAGGAAGGAAAACGG + Intergenic
1182142555 22:27973643-27973665 TTTTTGGTTTAGAATGAAAATGG + Intergenic
1183580563 22:38723639-38723661 ATTTGGAACCAGAAGGAACAAGG - Intronic
1183753061 22:39733210-39733232 ATTTGGGTCTTGAAATGAAAGGG + Intergenic
1183766589 22:39882317-39882339 AGTTGGGGATAGAGGGAAAAAGG + Intronic
1183830270 22:40415171-40415193 ATATTGTTCAAGAAGGAAAAGGG - Intronic
951122283 3:18943154-18943176 TTATAGGTCTAGAAGCAAAAAGG - Intergenic
951165152 3:19476747-19476769 ATATCATTCTAGAAGGAAAAAGG - Intronic
951345300 3:21541304-21541326 ATTTGGGGGCAGAAGGTAAATGG + Intronic
951347507 3:21563763-21563785 ACGTTGGTCTAGAAGGAATAGGG - Intronic
951777483 3:26325716-26325738 CTTTAGTTCAAGAAGGAAAATGG + Intergenic
952058759 3:29481353-29481375 GTTAGGTTCTAGAAGGCAAATGG + Intronic
952413706 3:33071824-33071846 ATGAGGGTCTAGAAGGGAGAAGG - Intronic
952505880 3:34006409-34006431 CTTTTGGTCTAGTAGGGAAAGGG + Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
955238359 3:57159675-57159697 ATTTGGGAGTAGATGGGAAATGG + Intronic
956930893 3:74041645-74041667 ACTTGGGTCTTGAAGCAGAAGGG + Intergenic
957501274 3:81060287-81060309 ATTTGTTTTTAGAAAGAAAAAGG + Intergenic
957520850 3:81316332-81316354 ATCTGGTTCTAGATGGAAACTGG + Intergenic
957974191 3:87422091-87422113 TTTTGAGTGTTGAAGGAAAAGGG - Intergenic
958268777 3:91472051-91472073 ATTTGTGTCTAGAAGTTAACAGG + Intergenic
958434024 3:94075914-94075936 ATATGGATCCAGAAGGACAAGGG - Intronic
959203348 3:103276107-103276129 ATTTGGGTATAGAACCATAATGG + Intergenic
959777437 3:110184328-110184350 ATTTAGGTATACAAAGAAAAAGG - Intergenic
960114574 3:113880257-113880279 ATTTGCCTCTAGAAAGAAAATGG - Intronic
960130057 3:114046119-114046141 ATTTAGGTATAGAAGGAATCAGG - Intronic
960263492 3:115594195-115594217 ATTTGGGACTAGATAGAAGATGG + Intergenic
961211763 3:125131042-125131064 ATTTGTGTGTGGAAGGAAAGAGG + Intronic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963512398 3:146264078-146264100 CTTTGGGTAGAGAAGGAAAGAGG + Intergenic
965768106 3:172152985-172153007 GTATGTGTTTAGAAGGAAAAAGG + Intronic
965789910 3:172375986-172376008 ATTTGTGTCTAGAAAAAAAGTGG - Intronic
965902997 3:173667382-173667404 ATTTTGGACTTGAAGAAAAATGG + Intronic
965969153 3:174532413-174532435 ATTTGAGTAGAGAAGGAAAGGGG + Intronic
966571258 3:181446093-181446115 ATGTGGTTCCAGAAGGAAAGTGG + Intergenic
967429849 3:189369610-189369632 ATTTGAGGCTGGAAGGAATAAGG - Intergenic
967649378 3:191966903-191966925 ATTTGACACTAGAAGCAAAAAGG - Intergenic
969810593 4:9644597-9644619 ATTTGGGTAGGGAAGGAAAAAGG - Intergenic
971016275 4:22492377-22492399 ATTGGGTTATTGAAGGAAAACGG - Intronic
972829648 4:42800620-42800642 ACTTGCCTCTAGAAGGAACATGG - Intergenic
973538845 4:51913860-51913882 ATATGTGTATAAAAGGAAAAAGG + Exonic
973891546 4:55372413-55372435 GTTTGGGCAAAGAAGGAAAAGGG - Exonic
974529850 4:63093599-63093621 ATTCTGGTCTAGATGGAATATGG + Intergenic
975327903 4:73080758-73080780 CTTTGGTTCTAGAAGGATACAGG - Intronic
975745537 4:77471319-77471341 CTTTAGTTCAAGAAGGAAAATGG + Intergenic
976798966 4:88966452-88966474 ATTTGGCTATAGCAGGAAAAAGG - Intronic
977579833 4:98713225-98713247 ATTTGGCTAAAGAAGGAATAAGG - Intergenic
978919920 4:114171203-114171225 ATTTTGGTTCAGAAAGAAAATGG - Intergenic
980628357 4:135405231-135405253 TTATAGGTCTAGAAGCAAAAGGG - Intergenic
983358473 4:166696887-166696909 ATTTGGGGCCTGAGGGAAAAGGG - Intergenic
983514620 4:168642968-168642990 ATTTGGAGCTGGAAGGAAAGGGG + Intronic
984551838 4:181170236-181170258 ATTTGGGTATAAAATAAAAATGG + Intergenic
984877018 4:184378337-184378359 ATGTGTGTCTGGAAAGAAAATGG - Intergenic
985225609 4:187758201-187758223 ATTTAGAGTTAGAAGGAAAAAGG + Intergenic
986137231 5:4992095-4992117 ATGTGGGTCTTGAAAGAAGAGGG - Intergenic
986185236 5:5429509-5429531 ATCTTGGGCTAGAAGGAAGACGG - Intronic
987500273 5:18699986-18700008 ATTTGGGTTATTAAGGAAAAAGG + Intergenic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
989853548 5:46248165-46248187 ATTGAGGTCTATAATGAAAAAGG - Intergenic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
993164506 5:84334993-84335015 ATTTGGAATTATAAGGAAAATGG - Intronic
993289790 5:86052243-86052265 ATTTGGTTCTGAAAAGAAAATGG - Intergenic
994425500 5:99579657-99579679 ATGTGTATCTAGAAGGAAAGAGG - Intergenic
994435842 5:99732578-99732600 ATGTGTATCTAGAAGGAAAGAGG + Intergenic
996171184 5:120293573-120293595 CTTTGGGTCTAGCAGGGAATTGG + Intergenic
996396209 5:123016707-123016729 ATTTGGATGTGGAAGGTAAAGGG + Intronic
996739664 5:126787334-126787356 ATTTGCTTCTAAATGGAAAATGG + Intronic
996867753 5:128146747-128146769 ATTTAGCTCTAGAAGATAAAAGG + Intronic
998813245 5:145987038-145987060 AGTTAGGTAAAGAAGGAAAAGGG + Intronic
1000218855 5:159191925-159191947 ATTCTGGTATATAAGGAAAAAGG - Intronic
1001575159 5:172758466-172758488 CTTTGGGTCTAGAAAGATAATGG - Intergenic
1001768369 5:174272982-174273004 CTTTGGGCCTAGAAGGATACAGG + Intergenic
1003469376 6:6414950-6414972 ATCTGAGTCTAGAAGGGAAAAGG + Intergenic
1004078577 6:12368506-12368528 ATTTGGGTCAAAAAGGAATAAGG + Intergenic
1004348322 6:14868872-14868894 AGTGGGGTCAGGAAGGAAAATGG - Intergenic
1005109076 6:22258851-22258873 ATGTGGGTAATGAAGGAAAAAGG + Intergenic
1005366949 6:25088137-25088159 ATTTGGGGATGTAAGGAAAAGGG + Intergenic
1006253728 6:32812940-32812962 ATTTGGGGCTGGAAGGAGTAAGG + Exonic
1006524343 6:34590910-34590932 ATTTTTGTCAAGAAGGAAATAGG - Intronic
1006749403 6:36367110-36367132 ACTTGAGTTTGGAAGGAAAAAGG + Intronic
1007447740 6:41920269-41920291 TCTTGGGTCTAGAGGAAAAAAGG - Intronic
1008626790 6:53325015-53325037 GTTTCGGTCTAGATGGAACAGGG - Intronic
1008718561 6:54320023-54320045 ATTTGGATTTGGAAGGCAAATGG + Intronic
1009174415 6:60442242-60442264 ATTTGTGTCTAGAAGTTAACAGG - Intergenic
1009675490 6:66814213-66814235 ATATGTGTTTTGAAGGAAAAAGG + Intergenic
1010114086 6:72280794-72280816 ATTTGTTTCTTGAAGGCAAAGGG - Intronic
1010928535 6:81772754-81772776 ATTTGGGTTTAGGGGGAAAATGG + Intergenic
1011967365 6:93175651-93175673 ATTTGGGTCCAGAAATTAAAAGG - Intergenic
1012487175 6:99735315-99735337 ATCTGGGTCTAGAGGATAAAGGG + Intergenic
1012709186 6:102577192-102577214 ATTTGGAGATAGAAGCAAAAAGG - Intergenic
1012740477 6:103009858-103009880 ACTTCAGTCTACAAGGAAAAAGG + Intergenic
1013450076 6:110271872-110271894 GTTTTTGTCTAGAAAGAAAATGG - Intronic
1013616087 6:111844814-111844836 ACTTGGGTCTTGAATTAAAATGG - Intronic
1013797169 6:113900754-113900776 AATTGGTTGAAGAAGGAAAAGGG - Intergenic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1014692187 6:124575512-124575534 ATTTGTGACTCAAAGGAAAATGG - Intronic
1014853805 6:126374359-126374381 CTTTGGGTTTAGAAATAAAATGG + Intergenic
1014990650 6:128071378-128071400 GTTTGGGTGTAAAAGCAAAAGGG - Intronic
1015389732 6:132668021-132668043 ATTTGGGGCTGGCAGGAGAAAGG + Intergenic
1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG + Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1015867896 6:137745783-137745805 ATTTTAGTCTAGAGGGAAAATGG - Intergenic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1020601532 7:10280222-10280244 AGCTTGGTATAGAAGGAAAATGG - Intergenic
1021850386 7:24802490-24802512 AATTGTGTCTGGAATGAAAAAGG - Intronic
1022426668 7:30275762-30275784 ATTGGTGTATAGAAGAAAAATGG + Intergenic
1024011665 7:45272036-45272058 AGTAGGGTCGAGAAGGAATATGG - Intergenic
1024311764 7:47975949-47975971 TTTTGGCTCAAGAAGGAATAGGG + Intronic
1024485988 7:49920129-49920151 ATTTGGATATGGAAGCAAAATGG + Exonic
1026538205 7:71257971-71257993 ATTTGGGTTTAGAAGCATAAAGG - Intronic
1027339246 7:77188347-77188369 ATTAGTGTCTCTAAGGAAAAGGG + Intronic
1027690458 7:81338334-81338356 ATCTGGATCTAGACGGAATAGGG + Intergenic
1028213049 7:88099094-88099116 ATTTTTGTCTTGCAGGAAAATGG + Intronic
1028462481 7:91111206-91111228 ATTTGGGTAGAGAAGGAAAAAGG - Intronic
1030564791 7:111140154-111140176 AGTTGGGGCAAGAAGGAAAGAGG + Intronic
1031542025 7:123006097-123006119 GGATGGGTCTAGCAGGAAAATGG - Intergenic
1031937924 7:127754952-127754974 ATTTAGGTCTAAAAGAAATAAGG - Intronic
1033050309 7:137998152-137998174 ATCTTGGTCTACAAGGACAAAGG - Intronic
1033201398 7:139374522-139374544 AGTTGTGTTTAAAAGGAAAAAGG + Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1034721972 7:153301677-153301699 AGCTTGGTCTGGAAGGAAAACGG + Intergenic
1038875984 8:31550029-31550051 ATTTGGTTTTAAAGGGAAAATGG - Intergenic
1038988741 8:32842898-32842920 ATTTAGTTCAATAAGGAAAAAGG + Intergenic
1039833031 8:41232860-41232882 ATTTGGGGCTATTATGAAAAAGG + Intergenic
1039841246 8:41294747-41294769 ATTTGAGTCTTGAATGTAAAAGG - Intronic
1040683297 8:49839723-49839745 ATTTGGGTCTACAAGGAATATGG - Intergenic
1041115382 8:54530842-54530864 ATTAGGAGCTAGAAGGATAATGG + Intergenic
1042067943 8:64899548-64899570 TTATAGGTCTAGAAGAAAAAAGG - Intergenic
1045794942 8:106031888-106031910 ATTTGAGTTTAGCAGGAACAAGG - Intergenic
1046009398 8:108528138-108528160 ATTTGGGTATAGAAAGTAGAGGG - Intergenic
1046649299 8:116819151-116819173 ATGTGGGGCTAAAAGGGAAAGGG + Intronic
1048544502 8:135374051-135374073 TTTTGAGACTAGTAGGAAAAAGG - Intergenic
1048954477 8:139524476-139524498 ATGTGGATCTAGAAGGCCAAAGG - Intergenic
1051178413 9:14384449-14384471 ATTTGGGCTTTGAAGGCAAAGGG - Intronic
1051966100 9:22831800-22831822 TTATAGGTCTAGAAGTAAAAAGG - Intergenic
1053446553 9:38157578-38157600 ATTTGTGTCTAGAAAGAAAGAGG - Intergenic
1053495785 9:38547072-38547094 GTTTGGGGTTGGAAGGAAAAGGG - Intronic
1056566021 9:87772867-87772889 ATTTGCCTCTAGAATGAAGAAGG + Intergenic
1057195286 9:93112977-93112999 CTTGGGGTCTAGAAGACAAAAGG - Exonic
1057676597 9:97140771-97140793 AGTTGGGGGTAGAAGAAAAAAGG - Intergenic
1058169638 9:101664837-101664859 ATTAGGATCAAGAAGAAAAATGG + Intronic
1058465115 9:105219389-105219411 ATTTTAGTCTGGAAGGAAAATGG + Intergenic
1058646890 9:107139290-107139312 ATTTGGGTCTTAAAGGATGATGG + Intergenic
1059044557 9:110851788-110851810 GTTTGTATCCAGAAGGAAAAAGG - Intergenic
1060098880 9:120819870-120819892 ATCTGGGTCTTGAAGGATACAGG - Intronic
1186014755 X:5178861-5178883 ATTTTGGTTTAGAAGAAGAAGGG - Intergenic
1186445524 X:9624603-9624625 ATTTGGGTTTTGCAGGAAATGGG + Intronic
1187901043 X:24026586-24026608 ATATTGGTCTAGAGAGAAAATGG - Intronic
1189312487 X:40029595-40029617 ATATGGGTCTTGAAGGACAGTGG - Intergenic
1190219226 X:48500302-48500324 AGCTGGCTCTAGAAGGAAGAAGG + Intergenic
1191157780 X:57294492-57294514 ATTTGGGAAAAGAAGGAAGAAGG - Intronic
1192680779 X:73251474-73251496 TTTTGGATGGAGAAGGAAAATGG - Intergenic
1192879875 X:75272568-75272590 TTTGGGGTCTTGGAGGAAAAGGG + Intergenic
1193493679 X:82183843-82183865 ATGTGTGTATAGCAGGAAAAGGG + Intergenic
1194487673 X:94505679-94505701 ATTTCATTCAAGAAGGAAAATGG + Intergenic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1196629575 X:117921995-117922017 GTTTGGGTTTACAAAGAAAAAGG - Intronic
1197004886 X:121483377-121483399 ATTTGGGTAGTGAAGGAATAGGG - Intergenic
1197183708 X:123563347-123563369 TTATGGGTCTAGAGGTAAAATGG - Intergenic
1199627393 X:149753033-149753055 TTATAGGTCTAGAAGTAAAAAGG + Intergenic
1201180113 Y:11334721-11334743 ATTTTGGTCATGAAAGAAAATGG + Intergenic
1201665601 Y:16450107-16450129 ATTTTGGTTTAGAAGAAGAAGGG + Intergenic