ID: 1020434865

View in Genome Browser
Species Human (GRCh38)
Location 7:8151711-8151733
Sequence CTGAGAAATGTGGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020434859_1020434865 4 Left 1020434859 7:8151684-8151706 CCGGTTGGTAAATGTTCCAGTGA 0: 1
1: 0
2: 0
3: 44
4: 695
Right 1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG No data
1020434858_1020434865 12 Left 1020434858 7:8151676-8151698 CCATGTGGCCGGTTGGTAAATGT 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020434865 Original CRISPR CTGAGAAATGTGGAGGTGGG TGG Intronic
No off target data available for this crispr