ID: 1020435563

View in Genome Browser
Species Human (GRCh38)
Location 7:8158712-8158734
Sequence GGTGAAATGAGACCAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020435558_1020435563 6 Left 1020435558 7:8158683-8158705 CCCTAACCCTTAAGTAGGTAAAA 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1020435563 7:8158712-8158734 GGTGAAATGAGACCAACAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 152
1020435561_1020435563 -1 Left 1020435561 7:8158690-8158712 CCTTAAGTAGGTAAAATTTGCAG 0: 1
1: 1
2: 1
3: 14
4: 145
Right 1020435563 7:8158712-8158734 GGTGAAATGAGACCAACAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 152
1020435560_1020435563 0 Left 1020435560 7:8158689-8158711 CCCTTAAGTAGGTAAAATTTGCA 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1020435563 7:8158712-8158734 GGTGAAATGAGACCAACAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 152
1020435559_1020435563 5 Left 1020435559 7:8158684-8158706 CCTAACCCTTAAGTAGGTAAAAT 0: 1
1: 0
2: 0
3: 17
4: 150
Right 1020435563 7:8158712-8158734 GGTGAAATGAGACCAACAGCAGG 0: 1
1: 0
2: 2
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020435563 Original CRISPR GGTGAAATGAGACCAACAGC AGG Intronic
904808937 1:33150957-33150979 GGTGATTTGAGACCAGCAACAGG + Intronic
908825591 1:68129986-68130008 TGTGAAATGAGACCAATCTCTGG + Intronic
909582060 1:77247598-77247620 GATGAAATGAGACAAAGAGTGGG + Intergenic
911187588 1:94919010-94919032 GGTGATGTAAGACCAACTGCAGG + Intronic
911243594 1:95491960-95491982 TGTGAAATGAGAGCAATAGCTGG + Intergenic
912466527 1:109878534-109878556 GGGAAAATGAGGCCAACAGTGGG - Intergenic
916787150 1:168094766-168094788 GGTGAAAGGAGACCATCACCTGG - Intronic
918055741 1:181020533-181020555 GAGGAAATGAGACCAGAAGCAGG + Intronic
918191005 1:182174497-182174519 GGTGAAATTTGGCCAACAACAGG + Intergenic
918272100 1:182912061-182912083 GGTGAAAGGAGAGCAAGAGAAGG - Intronic
918635504 1:186769420-186769442 GGTGAGAGGAGAACAACATCCGG - Intergenic
919022073 1:192119077-192119099 GGGGAAATGAGTCAAACAGATGG - Intergenic
919477134 1:198042899-198042921 GGTGATATGAGATCCAAAGCAGG + Intergenic
919869262 1:201808265-201808287 GGGCATATGAGACCAACAGATGG + Intronic
922850645 1:228730843-228730865 GGTGAAATGTTATCAATAGCAGG + Intergenic
924859543 1:247906568-247906590 GGTGTAATAACAACAACAGCCGG - Intergenic
924879887 1:248149263-248149285 AGAGAAATGAAACAAACAGCTGG - Intergenic
1064100121 10:12456426-12456448 GGTGAACTCAGACCACCAGTGGG + Intronic
1065483443 10:26216002-26216024 GCTGAAATGAGCCCATCAGCGGG + Intergenic
1066749444 10:38637689-38637711 TGTGAAATGGTACAAACAGCAGG - Intergenic
1066967202 10:42280103-42280125 TGTGAAATGGTACAAACAGCAGG + Intergenic
1067756163 10:49007457-49007479 GCTGAAATTAGACCAACTCCTGG + Intergenic
1070437837 10:76411065-76411087 GGTGAAATAAAAACAACAACAGG - Intronic
1071524024 10:86347814-86347836 GGTGATTTCAGACCCACAGCAGG + Intronic
1073460651 10:103663949-103663971 GCAGAAATGCAACCAACAGCCGG + Intronic
1073544500 10:104337355-104337377 TGTGAAATGAGACCAGTATCTGG + Intronic
1075111252 10:119586669-119586691 AGGGAAATGAGTCTAACAGCAGG - Intronic
1079907873 11:26271248-26271270 GCTGGGATGAGACCAACAGGTGG + Intergenic
1079939745 11:26664457-26664479 AGTGAAATGAAACAAACAGTTGG + Intergenic
1080874596 11:36264477-36264499 GTTGAAATGAAACCAACATGTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081480736 11:43486298-43486320 TGTGGACTGAGCCCAACAGCAGG - Intronic
1081499251 11:43649775-43649797 GGTGAAATAAGAGCAATACCTGG - Intronic
1082879494 11:58024295-58024317 GGTGTTATGAGACAGACAGCGGG - Intronic
1084021242 11:66419670-66419692 GGTGAAAAGAGAAAAAAAGCGGG + Intergenic
1087167405 11:95019375-95019397 GGTCACATGAGACAAACATCAGG - Intergenic
1091844731 12:3647132-3647154 GGTGGAATCAGGACAACAGCTGG - Intronic
1098137320 12:67416408-67416430 GGAGATATGAGACCAACGTCAGG - Intergenic
1101223584 12:102665831-102665853 AGTGAAATTAAACCAACAGGAGG - Intergenic
1104947419 12:132422347-132422369 GGGGAAATGCGAGCAGCAGCAGG + Intergenic
1107359887 13:39606925-39606947 GGTGAAAGGAGAGCAGAAGCAGG - Intergenic
1108533014 13:51345117-51345139 GGTGAACTGAGACAATCAACTGG - Intronic
1108633388 13:52308983-52309005 GGTGAAAAGACAGTAACAGCCGG + Intergenic
1109578399 13:64292676-64292698 TGTGAAATGACCCCATCAGCTGG - Intergenic
1110835534 13:80077915-80077937 TGTGAAATGGGACCAATAGGAGG + Intergenic
1111252484 13:85621187-85621209 GGTGAAATGTCACCAACTGGTGG - Intergenic
1111999201 13:95194152-95194174 AGGCAAATGGGACCAACAGCAGG - Intronic
1114370874 14:22086669-22086691 GGAGAAAAGTGACCAGCAGCAGG + Intergenic
1119659059 14:76437712-76437734 GCTGGAATGTGACCCACAGCTGG + Intronic
1119734743 14:76974785-76974807 AGTGAAATCAGCCCCACAGCTGG + Intergenic
1120123989 14:80719022-80719044 GGTAAAGTGAGGCCATCAGCAGG + Intronic
1120303983 14:82744479-82744501 GGTGACAGGAGAAAAACAGCTGG + Intergenic
1120710097 14:87784428-87784450 GTTGAAAAGAGCCAAACAGCTGG - Intergenic
1121051825 14:90824223-90824245 GGAGAAATGGGTTCAACAGCGGG - Intergenic
1127554615 15:60075494-60075516 GGGGATATGAGAACAATAGCAGG - Intergenic
1132100190 15:99017483-99017505 GCTGAAATGACAGCAACAGATGG - Intergenic
1133100544 16:3476502-3476524 GGTGGAAAGAGCCCAGCAGCAGG - Intronic
1133708090 16:8374834-8374856 GGTGAGATGAGTCCCACAGCTGG + Intergenic
1134693111 16:16203914-16203936 TGTGAAATGGGAACAACACCTGG - Intronic
1134978737 16:18590781-18590803 TGTGAAATGGGAACAACACCTGG + Intergenic
1135196713 16:20401056-20401078 GGTCAAATGAAACCAACAAAGGG + Intronic
1136368491 16:29821002-29821024 GATCGACTGAGACCAACAGCTGG - Intronic
1141876197 16:86826205-86826227 GGTGAAATGAGTCCCACACCAGG - Intergenic
1142865901 17:2791323-2791345 TGTGAACTGTGACCCACAGCAGG + Intronic
1143634860 17:8158813-8158835 GTAGAAAGGAGTCCAACAGCAGG + Intronic
1150607922 17:66710188-66710210 GGTCAAATGAGACCTGCACCTGG + Intronic
1153475379 18:5493636-5493658 TGGAAAGTGAGACCAACAGCAGG - Intronic
1155623868 18:27812535-27812557 GTTAAAATGAGGCCATCAGCTGG + Intergenic
1156893345 18:42215432-42215454 GGTGAAAAAAGACCATCAGGTGG + Intergenic
1161716998 19:5881966-5881988 GGTGAAATCAGAGCCACACCAGG + Intronic
1167405399 19:49304052-49304074 TGTGACATGAGACCAGCAACTGG + Intronic
925080568 2:1060838-1060860 GGTGAAGTCAGACCAGGAGCAGG + Intronic
926371559 2:12184005-12184027 GGTGGAATAAGAGAAACAGCAGG + Intergenic
927020397 2:19010721-19010743 GGTGAAAAGAGACCACCTGTTGG + Intergenic
928099731 2:28429635-28429657 GCAGAAAGGTGACCAACAGCAGG - Intergenic
928403009 2:30992781-30992803 AGTCAAAAGAGATCAACAGCAGG - Intronic
929422498 2:41807368-41807390 AGTGAAGTGGGACCAAAAGCTGG - Intergenic
932884318 2:75534363-75534385 GGTGAAATGGCACCAGCAGATGG + Intronic
933173304 2:79149245-79149267 GGTGAAATGAGAGCAAGGACTGG - Intergenic
933266460 2:80186020-80186042 GGAGAAAGGAGAGCACCAGCTGG - Intronic
934312441 2:91879807-91879829 TGTGAAATGGTACAAACAGCAGG - Intergenic
937034572 2:118770053-118770075 GAAGAAATGAGAGGAACAGCTGG + Intergenic
940476143 2:154165767-154165789 AGTGAAATTAGACCAAGATCTGG + Intronic
943179410 2:184524461-184524483 GGTGATAGGAGACCAACAGTGGG + Intergenic
945499368 2:210551258-210551280 TGTGAAATGAGAAGAACAGTGGG - Intronic
947035370 2:225847704-225847726 GTTGAAATGAGAACAAAAGATGG - Intergenic
948584704 2:239012152-239012174 GGGGAAGTGCGAGCAACAGCTGG - Intergenic
1169503647 20:6185306-6185328 TGTAAAATGAGGGCAACAGCAGG - Intergenic
1170015075 20:11771291-11771313 GCAGAAATGAGACAAACACCTGG - Intergenic
1170558312 20:17533465-17533487 GCTGAAAGGAGACCTACAGCTGG - Intronic
1171442720 20:25178246-25178268 GGTGAAATGAGAACAACCGCAGG + Intergenic
1173890728 20:46507656-46507678 GGTGAGGTGAGACATACAGCAGG - Intronic
1174481876 20:50837110-50837132 TGTAAAATGAGACTAATAGCAGG - Intronic
1177644767 21:23887240-23887262 GGTGGAAGAAGACAAACAGCTGG + Intergenic
1179120928 21:38544968-38544990 GGAGAAAGAAGACCAAGAGCGGG - Intronic
1179275392 21:39887676-39887698 AGTGAAATGGCATCAACAGCCGG - Intronic
1180107395 21:45629190-45629212 GGTGAAATGAGGCCAGCAACAGG - Intergenic
1180539195 22:16425642-16425664 TGTGAAATGGTACAAACAGCAGG - Intergenic
1182860846 22:33558023-33558045 TTTAAAATGACACCAACAGCTGG - Intronic
953467413 3:43134910-43134932 GATGAAATGAGACTGACAACAGG + Intergenic
957005857 3:74945895-74945917 GCTGAAATGAGACCTACGGGCGG - Intergenic
958149943 3:89678577-89678599 GGTGTAATGAGAGGAACACCAGG - Intergenic
960821729 3:121740474-121740496 GGTGAAATGTGAACAACGTCTGG + Intronic
961759471 3:129155011-129155033 AGAGAAAACAGACCAACAGCTGG - Intronic
962949147 3:140202135-140202157 TGTGAAATGGGAGCTACAGCAGG + Intronic
963965089 3:151359390-151359412 TGTGAAATGACATCAACAGATGG - Intronic
964555812 3:157936689-157936711 GAAGAAATGAGACCAACAGCAGG - Intergenic
966707816 3:182935865-182935887 CGTTAAATGAAACCTACAGCAGG + Intergenic
966968212 3:185017439-185017461 GGTGAAATTAAACGAACAGGAGG - Intronic
968082982 3:195859742-195859764 GGTGAAATGATAAGAACTGCAGG - Intergenic
968597429 4:1492642-1492664 GGTGGACTGAGCCCAGCAGCTGG - Intergenic
969539992 4:7782287-7782309 GGGGACATGAGACCACCTGCAGG + Intronic
970113053 4:12660377-12660399 GGATAAAAGAGACAAACAGCAGG - Intergenic
970818481 4:20186337-20186359 GGAGAAATGGAACCAATAGCAGG - Intergenic
974631436 4:64494448-64494470 GGTGAATTTAGTCCCACAGCTGG + Intergenic
978946862 4:114510137-114510159 GATGAAATGAAAGAAACAGCTGG - Intergenic
981719557 4:147787700-147787722 GGTGAAATGAGAAGGACAACAGG - Intronic
984188773 4:176579367-176579389 GGTGTAAACAGACCAACAGCAGG - Intergenic
985615983 5:922338-922360 GGTGAAATGCCACCAAGAGCAGG - Intergenic
987594217 5:19974797-19974819 TGTGATATGAGCCCATCAGCTGG + Intronic
990528353 5:56650518-56650540 GGAGAGATGAGAGCAACAGGAGG + Intergenic
992434901 5:76746601-76746623 TGTGAAATGAGAAAAACAGGTGG + Intergenic
992576111 5:78114748-78114770 GGTTAAATAATACCAACATCAGG + Intronic
993528477 5:88996192-88996214 GGAGAAAGGAGATGAACAGCTGG - Intergenic
1000336682 5:160246552-160246574 CGTGAGCTGAGACCTACAGCAGG + Intergenic
1001275706 5:170349675-170349697 CTAGAAATGAGACCATCAGCAGG - Intergenic
1003357199 6:5384908-5384930 GAGGAAATGAGACAAGCAGCAGG + Intronic
1004854383 6:19734478-19734500 GGGGCAGTGATACCAACAGCGGG - Intergenic
1005295889 6:24427078-24427100 GGTGAGATGATACTAAAAGCAGG - Intronic
1006390889 6:33757798-33757820 GGTGAAAAGAGACAGACAGGTGG + Intergenic
1007479511 6:42141218-42141240 GCTGAACTGAGTCCAACAGCAGG + Intronic
1012112907 6:95259727-95259749 GGGGAAATGATACGAACAGGAGG - Intergenic
1014683618 6:124466431-124466453 GCTGAAATGAGGCCAAGGGCAGG - Intronic
1018233914 6:161704278-161704300 GGGGAAAATAGTCCAACAGCTGG - Intronic
1019917102 7:4140575-4140597 GGGGAGCTGAGGCCAACAGCAGG + Intronic
1020435563 7:8158712-8158734 GGTGAAATGAGACCAACAGCAGG + Intronic
1022604698 7:31799230-31799252 GGAGAAAAGAGTCAAACAGCAGG - Intronic
1024446422 7:49484797-49484819 GGTGAAATGGAACCAAGAACTGG - Intergenic
1024474708 7:49798343-49798365 GGTGAAATGAGCCTAAAAGAGGG + Intronic
1026994199 7:74605338-74605360 AGGCAAATGAGACCCACAGCAGG + Intergenic
1029170132 7:98624659-98624681 GGTGACATGAAACCAGCAGCAGG - Intronic
1032376133 7:131419795-131419817 GGTGAAATCAGAGAAATAGCTGG + Intronic
1032376165 7:131420210-131420232 TGTGGAATGAGCCCATCAGCTGG + Intronic
1033150178 7:138907578-138907600 GCAGGAATGAGACCAAGAGCAGG + Intronic
1036155162 8:6334923-6334945 GGTTCAGTGAAACCAACAGCAGG + Intergenic
1037272597 8:17146099-17146121 GGTGATGTGAGAGGAACAGCAGG + Intergenic
1037438918 8:18893926-18893948 TGTGAAATAAGAAGAACAGCGGG - Intronic
1041614477 8:59889688-59889710 GATAGAATTAGACCAACAGCTGG - Intergenic
1043159845 8:76832605-76832627 GGTAAAATGGAATCAACAGCAGG + Intronic
1043863776 8:85352565-85352587 TGTGAAATAAGACCAACCACAGG - Intronic
1047254710 8:123206776-123206798 GATGAAATGAGCCCAAGAGGAGG + Intronic
1048842940 8:138581010-138581032 GGTGAAATGAGTTCAAGAGCAGG - Intergenic
1051190037 9:14501733-14501755 GGTGCAATGAGAGCATCAGAGGG + Intergenic
1052067122 9:24035608-24035630 GATCAAATGAGACAAACACCAGG - Intergenic
1052252217 9:26411887-26411909 GGTGAGATGCGACCAACTCCGGG + Intergenic
1053131236 9:35616967-35616989 GGTGAATTGGGACCATCCGCAGG + Intronic
1056450171 9:86709149-86709171 GTTGAAATGTCACCAACTGCAGG - Intergenic
1057810389 9:98252830-98252852 GGCCACATGAGAACAACAGCGGG + Intronic
1058583886 9:106486287-106486309 GAGAAAATGAGACCAACATCAGG - Intergenic
1060909978 9:127341768-127341790 GGTGAAATGAAACGAAGGGCTGG + Intronic
1061759179 9:132838121-132838143 GGAGAAATAAAACAAACAGCTGG + Intronic
1186406789 X:9311592-9311614 GGTGAGATGAGGTCATCAGCAGG - Intergenic
1187301719 X:18057496-18057518 GTTGAAATGAGATCAATAGATGG + Intergenic
1189173139 X:38928757-38928779 GGTGAAATGACACCAAAAAGTGG - Intergenic
1190519380 X:51261869-51261891 TGTCTAATGAGACCAACATCTGG - Intergenic
1195268888 X:103211733-103211755 GGTGAAAGGAGAGCAAGAGAAGG + Intergenic
1196520200 X:116663238-116663260 GGGGAAATGAGACAGACAGGTGG - Intergenic
1200293630 X:154895180-154895202 GGTGAAATCCAACCAAAAGCTGG + Intronic
1201180401 Y:11337298-11337320 TGTGAAATGGTACAAACAGCAGG - Intergenic