ID: 1020445173

View in Genome Browser
Species Human (GRCh38)
Location 7:8261431-8261453
Sequence CCTGGCGCGCCCGTTTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445173_1020445183 5 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445183 7:8261459-8261481 CTGGAACCGGGGTTGCTTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1020445173_1020445181 3 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445181 7:8261457-8261479 TGCTGGAACCGGGGTTGCTTAGG No data
1020445173_1020445178 -7 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445178 7:8261447-8261469 CGCCAGGGTTTGCTGGAACCGGG 0: 1
1: 0
2: 1
3: 14
4: 105
1020445173_1020445177 -8 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG No data
1020445173_1020445182 4 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445182 7:8261458-8261480 GCTGGAACCGGGGTTGCTTAGGG 0: 1
1: 0
2: 0
3: 15
4: 284
1020445173_1020445179 -6 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445179 7:8261448-8261470 GCCAGGGTTTGCTGGAACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445173 Original CRISPR CCTGGCGCGCCCGTTTCCTT TGG (reversed) Intronic
903044313 1:20553933-20553955 CCTGGCCCGCCCGCTCCCTGGGG - Exonic
907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG + Intronic
912586170 1:110768014-110768036 CCTGAAGTGCCCTTTTCCTTTGG + Intergenic
916739446 1:167635542-167635564 CTTGGCGCGCGCGGTTCCGTGGG + Intronic
1063115440 10:3068599-3068621 CCCGGCGCGCCCGCGTCCGTGGG - Intronic
1076494171 10:130885973-130885995 CCTGCCGTGCCTGTTTTCTTTGG + Intergenic
1088037417 11:105334359-105334381 CCTGGCCAGACTGTTTCCTTAGG + Intergenic
1099014389 12:77326457-77326479 CCTGGCTCTCCAGTTTTCTTAGG - Intergenic
1103749906 12:123151292-123151314 CCCGGCTCGCCCGTGTCCTCAGG + Intergenic
1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG + Intergenic
1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG + Intronic
1114265764 14:21071619-21071641 CCTGCCGCGGCCGTTTCCTGTGG + Intronic
1121566697 14:94915271-94915293 CCCGGCTCTCCCTTTTCCTTTGG + Intergenic
1143107521 17:4536979-4537001 CCTGGCCTTCCCCTTTCCTTAGG - Intronic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG + Exonic
1164576270 19:29407170-29407192 CCTGGCTCCCCCGATCCCTTAGG + Intergenic
1164601243 19:29565046-29565068 CAGGGCATGCCCGTTTCCTTAGG - Intergenic
1165798743 19:38534877-38534899 CCTGGCTCGCCCATTCCCTGTGG + Intronic
937870425 2:126782272-126782294 CCTTGCGCTCCCGTCCCCTTGGG - Intergenic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
945373586 2:209051993-209052015 CCTGGAGGGCACTTTTCCTTTGG - Intergenic
948007767 2:234624420-234624442 CCTGGGGCCCCCGTATCCTTGGG + Intergenic
1172280322 20:33703415-33703437 CCTGGCCCCACAGTTTCCTTGGG - Exonic
1174607071 20:51768566-51768588 CATGGTGCGCCCGTGTCCGTCGG - Exonic
1175228617 20:57459859-57459881 CCTGGGGAGACCGTTTCCCTAGG + Intergenic
1178962934 21:37084607-37084629 CCTGGCTCTCTTGTTTCCTTGGG - Intronic
1179209497 21:39313392-39313414 CCTGGCGCTCCCGGCTGCTTCGG - Intronic
1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG + Intergenic
1184129457 22:42509142-42509164 CCTGGCGCCCATGTCTCCTTGGG - Intergenic
955996552 3:64685726-64685748 CCTGCGGCGCACGTTTCCCTAGG - Intronic
979690424 4:123553430-123553452 CCAGGCTCGCCCATTTCCTAGGG + Intergenic
997647210 5:135489424-135489446 CCTTGCGCGCCTGTTCCCCTGGG + Intergenic
998152310 5:139764482-139764504 CCTGGCGCGCCCGCTCCCTGGGG + Intergenic
1010682122 6:78809303-78809325 CCAGGGGCGCCCATTTCCCTAGG - Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1034174535 7:149090542-149090564 CCGGGCTCGCCCGTGTCCTGGGG - Intronic
1037193166 8:16152359-16152381 CCTGGCCCGCCCCTTCCCATAGG - Intronic
1049905794 9:215155-215177 CCTGGGGCGCCCGGTTCCCGAGG + Exonic
1061254444 9:129446033-129446055 CCTGGCTCGCCTGTGTCCTCAGG + Intergenic
1061762263 9:132858940-132858962 CCTGGTGCTCCAGTTTCCCTGGG + Intronic
1062688781 9:137830200-137830222 GCAGGCGAGCCCGTCTCCTTTGG + Intronic
1186433398 X:9523370-9523392 CCTGGGGTGCCCCTTTCCCTGGG + Intronic