ID: 1020445177

View in Genome Browser
Species Human (GRCh38)
Location 7:8261446-8261468
Sequence GCGCCAGGGTTTGCTGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445166_1020445177 24 Left 1020445166 7:8261399-8261421 CCCCGGAGCAGGAAAGGCGGAGT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG No data
1020445167_1020445177 23 Left 1020445167 7:8261400-8261422 CCCGGAGCAGGAAAGGCGGAGTC 0: 1
1: 0
2: 1
3: 20
4: 180
Right 1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG No data
1020445168_1020445177 22 Left 1020445168 7:8261401-8261423 CCGGAGCAGGAAAGGCGGAGTCA 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG No data
1020445173_1020445177 -8 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG No data
1020445172_1020445177 -7 Left 1020445172 7:8261430-8261452 CCCAAAGGAAACGGGCGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1020445177 7:8261446-8261468 GCGCCAGGGTTTGCTGGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445177 Original CRISPR GCGCCAGGGTTTGCTGGAAC CGG Intronic
No off target data available for this crispr