ID: 1020445178

View in Genome Browser
Species Human (GRCh38)
Location 7:8261447-8261469
Sequence CGCCAGGGTTTGCTGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445166_1020445178 25 Left 1020445166 7:8261399-8261421 CCCCGGAGCAGGAAAGGCGGAGT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1020445178 7:8261447-8261469 CGCCAGGGTTTGCTGGAACCGGG 0: 1
1: 0
2: 1
3: 14
4: 105
1020445172_1020445178 -6 Left 1020445172 7:8261430-8261452 CCCAAAGGAAACGGGCGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1020445178 7:8261447-8261469 CGCCAGGGTTTGCTGGAACCGGG 0: 1
1: 0
2: 1
3: 14
4: 105
1020445167_1020445178 24 Left 1020445167 7:8261400-8261422 CCCGGAGCAGGAAAGGCGGAGTC 0: 1
1: 0
2: 1
3: 20
4: 180
Right 1020445178 7:8261447-8261469 CGCCAGGGTTTGCTGGAACCGGG 0: 1
1: 0
2: 1
3: 14
4: 105
1020445173_1020445178 -7 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445178 7:8261447-8261469 CGCCAGGGTTTGCTGGAACCGGG 0: 1
1: 0
2: 1
3: 14
4: 105
1020445168_1020445178 23 Left 1020445168 7:8261401-8261423 CCGGAGCAGGAAAGGCGGAGTCA 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1020445178 7:8261447-8261469 CGCCAGGGTTTGCTGGAACCGGG 0: 1
1: 0
2: 1
3: 14
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445178 Original CRISPR CGCCAGGGTTTGCTGGAACC GGG Intronic
900123963 1:1061427-1061449 GGCCAGGGTGGGCTGGAGCCGGG + Intergenic
900371040 1:2332323-2332345 CACCAGGGTGTGCTGAGACCGGG - Intronic
901493824 1:9610209-9610231 CTCCAGGGTTTGCTGCTATCTGG + Intronic
901924235 1:12555694-12555716 GGCAAAGGTGTGCTGGAACCTGG + Intergenic
903362412 1:22784879-22784901 CGACAGGGTTTCCTGGAAGATGG - Exonic
904475166 1:30760175-30760197 GGCCAGTGTGTGCTGGAGCCTGG - Intergenic
905274203 1:36806547-36806569 GGCCAGGGTTTCCAGGAAGCAGG - Intronic
911388924 1:97214121-97214143 CCCCAAGGCTTGCTGGAACCTGG - Intronic
915111193 1:153565631-153565653 GGCCAGGGTTTGGTGGGATCAGG - Exonic
921670791 1:217921676-217921698 CTGCAGGGTTTGCAGGAAGCAGG + Intergenic
921801097 1:219403362-219403384 CCCCAGGGTTTTCTGAAAGCTGG - Intergenic
922641687 1:227238381-227238403 GGCCATGGTTTGCTGAAACCTGG - Intronic
922695251 1:227728237-227728259 CTGCAGGGTTCGCTGGACCCTGG + Intergenic
1062964521 10:1596846-1596868 AGCCAGGATTTACTGGCACCCGG + Intronic
1065971854 10:30812029-30812051 TGCATGGGTCTGCTGGAACCGGG - Intergenic
1074436241 10:113436716-113436738 CGCCTGGGTTTGAAGGTACCTGG + Intergenic
1076096113 10:127736302-127736324 CGCCCGGGGTTGCTGCAGCCCGG - Intergenic
1076475590 10:130749666-130749688 GGCCAGGGTTTGTTGGAGGCAGG + Intergenic
1084115994 11:67043222-67043244 GGCCAGGCTCTGCAGGAACCTGG + Intronic
1085877815 11:80430115-80430137 CAACAGGGTTGGATGGAACCAGG - Intergenic
1086103866 11:83128933-83128955 AGCCTGGGTCTGCTGGAACTTGG - Intergenic
1091721157 12:2815065-2815087 GGCCAAGGTTCGCTTGAACCTGG - Intronic
1099067864 12:78006514-78006536 CGCCAGGGCTTGCTGGCACTTGG - Exonic
1104497910 12:129257880-129257902 CACCAGGTGTTGCTGGACCCAGG - Intronic
1104505120 12:129324732-129324754 AGGCAGGGATTGCTTGAACCTGG + Intronic
1107016261 13:35710050-35710072 TGACTGGGTTTGCTGGAGCCAGG + Intergenic
1109139883 13:58701865-58701887 TGCCAGTGTCTGCAGGAACCAGG + Intergenic
1123739997 15:23226634-23226656 AGCCAGGATCTGCTGGATCCTGG + Intergenic
1124291221 15:28455602-28455624 AGCCAGGATCTGCTGGATCCTGG + Intergenic
1124685218 15:31776710-31776732 TGCCAGGGTCTGAAGGAACCGGG + Intronic
1126141117 15:45439574-45439596 CGCCAGGGTTTGCTGCAAGCAGG + Intronic
1126392746 15:48177734-48177756 CGCCACGGTTTGCAGGAAAATGG - Intronic
1128180969 15:65603708-65603730 GGCCATGGTTGGCTGGACCCTGG - Intronic
1128517325 15:68350865-68350887 CCCCAGGGTGGGCTGGAGCCAGG + Intronic
1130994664 15:88897182-88897204 CCCCAGGGTATGCTGGAACAGGG + Intergenic
1132310524 15:100854238-100854260 AGCCAGGGTCTGCTGAAACCAGG - Intergenic
1132903102 16:2268837-2268859 CGCCGAGGTTCGCTGGAAGCAGG + Intergenic
1133197480 16:4181764-4181786 CCCCTGGGTATACTGGAACCTGG - Intergenic
1135299525 16:21313530-21313552 CACCAGGCTGGGCTGGAACCTGG + Intergenic
1136707550 16:32202062-32202084 AGCCAGGATCTGCTGGATCCTGG - Intergenic
1136760360 16:32727348-32727370 AGCCAGGATCTGCTGGATCCTGG + Intergenic
1136807744 16:33143038-33143060 AGCCAGGATCTGCTGGATCCTGG - Intergenic
1138700719 16:58860041-58860063 TGTCAGGGGTTGCTGGGACCTGG + Intergenic
1141427511 16:83953507-83953529 CGCCTGGGTTCTCTGGAGCCCGG + Intronic
1203062514 16_KI270728v1_random:987670-987692 AGCCAGGATCTGCTGGATCCTGG + Intergenic
1143253639 17:5540123-5540145 CTCCAGTGTTTGCTGTAAACAGG - Intronic
1144808129 17:17981044-17981066 AGCCAGGGTTTCCTGGAGCGTGG - Intronic
1145974020 17:28973937-28973959 CTCCATGGTCTGCTGGAAGCAGG - Intronic
1147363777 17:39947052-39947074 CACCAGGAAATGCTGGAACCTGG + Intergenic
1148132995 17:45273651-45273673 AGCCAGGGTGGGCTGGGACCCGG - Intronic
1148190548 17:45675739-45675761 AGCCAGGATATGCTGGAGCCAGG + Intergenic
1149785259 17:59429356-59429378 CTCCAGGGATTGCTGGAACTTGG - Intergenic
1149882623 17:60308180-60308202 CGCAAGGGTTTTCTGTATCCCGG - Intronic
1152016459 17:77754043-77754065 AGCCAGGGTCTGCAGGCACCAGG - Intergenic
1155046874 18:22110481-22110503 AGCCAGGTTTTCCTGGAGCCAGG - Intergenic
1161641272 19:5424843-5424865 CCACTGGGGTTGCTGGAACCAGG + Intergenic
1164674131 19:30090637-30090659 CCCCAGGGTGTGCTGGGACACGG + Intergenic
1165698308 19:37918112-37918134 CCTCTAGGTTTGCTGGAACCTGG + Intronic
1165800051 19:38543781-38543803 CGCCAGGCTCTGCTGGTTCCCGG - Exonic
925884434 2:8382312-8382334 CGCCAGGGGCTGCTGGAGCTGGG - Intergenic
930610836 2:53541265-53541287 CTCCAGGGCTTGCTGCAATCTGG + Intronic
933586653 2:84186655-84186677 CCCCAGGGATTGCTGGAAGAAGG - Intergenic
946224830 2:218258886-218258908 GGACGGGGTTTGCTGGACCCTGG - Intergenic
947970891 2:234323643-234323665 CTCCAGGATTTGGTGAAACCTGG + Intergenic
948230105 2:236343011-236343033 GGGCAGGGTTTGCGGGAATCGGG + Intronic
1168876688 20:1176842-1176864 TCCCAGGTTTAGCTGGAACCTGG + Intronic
1174603856 20:51746241-51746263 CACCGGGGTTTGCTGTACCCAGG - Intronic
1175333423 20:58179738-58179760 CGCCTGGAGTTGCAGGAACCGGG + Intergenic
1176428061 21:6560805-6560827 CCCCAGGGTGCGCTTGAACCAGG - Intergenic
1179227043 21:39463529-39463551 CGCCTGGGACTGCTGGAGCCAGG + Intronic
1179548851 21:42130539-42130561 CCCCAGGTTTTGCTGGTACATGG + Intronic
1179703552 21:43169122-43169144 CCCCAGGGTGCGCTTGAACCAGG - Exonic
1181519149 22:23435394-23435416 CGCCAGGGTTCGCTCTATCCTGG + Intergenic
1182766387 22:32760915-32760937 CGCCAGTGTTTCCTTGACCCTGG - Intronic
1183239804 22:36649262-36649284 TGTCAGGATTTGCTGGAAACAGG - Intronic
950623801 3:14229588-14229610 CTCCAGGCCTTGCTGGAATCCGG - Intergenic
951720896 3:25696971-25696993 CGCCAGAGTTGGCTGAATCCTGG - Intergenic
955134306 3:56200731-56200753 CGTCTGTGTTTGTTGGAACCAGG + Intronic
962214992 3:133513489-133513511 TACCAGGGTTTCCTGGAACCAGG + Intergenic
962215198 3:133514999-133515021 TACCAAGGTTTCCTGGAACCAGG - Intergenic
962879543 3:139563379-139563401 TTCCAGGATTTGCTGGGACCTGG + Intronic
969673570 4:8602777-8602799 ACCCAGGGCTTGCTGGAGCCCGG - Intronic
975896143 4:79093294-79093316 AGGCAGGGTGTGGTGGAACCAGG - Intergenic
982644306 4:158004260-158004282 GGCCAGGGTTTGCTTGAGCCAGG - Intergenic
984840865 4:184066071-184066093 TGCCAGGGTTTCCTGGGACTGGG - Intergenic
989122566 5:38019051-38019073 CGTCAGGGAGTGCTGGAATCAGG - Intergenic
990251556 5:53920812-53920834 TGCCAGGGTTGGCTGTAGCCAGG + Intronic
997364532 5:133317472-133317494 CGCCTGGCTTTGCTGAATCCTGG + Intronic
1002583935 5:180229489-180229511 CCCCAGGATTTCCTGGAATCTGG - Intergenic
1004126871 6:12882689-12882711 CGATAGGGTTTGCTCCAACCTGG - Intronic
1005512081 6:26520635-26520657 CTCCAGTTTTTGCTGGAACAAGG - Intergenic
1007189816 6:40003857-40003879 TACCAGGGTTTGGTGGGACCTGG - Intergenic
1011052454 6:83168090-83168112 TGCCTGGCTTTGCTGGAACATGG - Exonic
1013046890 6:106495268-106495290 CACCAGGGTATGCTGGAAGGAGG + Intergenic
1013096100 6:106946373-106946395 AGGCAGGGATTGCTGGAACCTGG + Intergenic
1013293624 6:108739639-108739661 AGCCAGTGTTTGCTGGAAGCTGG + Intergenic
1015984366 6:138870946-138870968 AGCCAAGGTTTGCTTGAACCCGG + Intronic
1018975739 6:168563958-168563980 CTCCAGGGTGTGCTTTAACCAGG - Intronic
1019592132 7:1840932-1840954 CGCCAGGGTTTGCTCTATCCTGG - Intronic
1020445178 7:8261447-8261469 CGCCAGGGTTTGCTGGAACCGGG + Intronic
1026515093 7:71062589-71062611 CACCAGGGCTTTCTGGAGCCTGG + Intergenic
1029674818 7:102061265-102061287 AGCCAGTGTGTGCTGGAACTAGG + Intronic
1033265674 7:139884624-139884646 GGCCAGTGTTTGCTGGAATGGGG - Intronic
1035198377 7:157241986-157242008 CGCCAGGGCTGGGAGGAACCAGG + Intronic
1035475916 7:159144450-159144472 GTCCGGGGTTTGCTGGAAACGGG - Intronic
1036361231 8:8078359-8078381 TGCCTGGGTTTTCTGGAAGCGGG - Intergenic
1036978281 8:13439764-13439786 AGCGAGGGTTTTCTGGAAGCTGG - Intronic
1039325102 8:36476297-36476319 GGTCAGGGTTAGCTAGAACCAGG - Intergenic
1039548775 8:38428744-38428766 CACCTGGGTGTGCTGGAGCCAGG + Intronic
1041120333 8:54579994-54580016 TGTCAGGGTTTGTTGGTACCTGG - Intergenic
1041389170 8:57333794-57333816 CCCCAGGGTATGCGGGAGCCAGG - Intergenic
1047314396 8:123719030-123719052 CCCCAGAGTTTGCTGCAACCTGG - Intronic
1048856701 8:138692782-138692804 CTCCAGGCTGAGCTGGAACCAGG + Intronic
1049742685 8:144248663-144248685 TGCCAGGGCCTGCTGGAACCTGG - Intronic
1049743183 8:144250677-144250699 CTCCAGTGTGTGCTGGAGCCTGG - Intronic
1056461894 9:86816721-86816743 GGCCAGGGTTTGATGGGACAGGG - Intergenic
1059557661 9:115297613-115297635 GGCCATGGTTTGCTGACACCTGG + Intronic
1060200504 9:121649499-121649521 CTCCAGGGAGGGCTGGAACCTGG + Intronic
1062715991 9:138010325-138010347 CGGCAGGGTGTGCTGGGAGCAGG + Intronic
1190853824 X:54273446-54273468 AGCCAGGAATTGCTTGAACCCGG + Intronic
1200985790 Y:9303051-9303073 GGCCAGGGTGTGCTGGGGCCAGG - Intergenic