ID: 1020445181

View in Genome Browser
Species Human (GRCh38)
Location 7:8261457-8261479
Sequence TGCTGGAACCGGGGTTGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445172_1020445181 4 Left 1020445172 7:8261430-8261452 CCCAAAGGAAACGGGCGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1020445181 7:8261457-8261479 TGCTGGAACCGGGGTTGCTTAGG No data
1020445173_1020445181 3 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445181 7:8261457-8261479 TGCTGGAACCGGGGTTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445181 Original CRISPR TGCTGGAACCGGGGTTGCTT AGG Intronic
No off target data available for this crispr