ID: 1020445182

View in Genome Browser
Species Human (GRCh38)
Location 7:8261458-8261480
Sequence GCTGGAACCGGGGTTGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445173_1020445182 4 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445182 7:8261458-8261480 GCTGGAACCGGGGTTGCTTAGGG 0: 1
1: 0
2: 0
3: 15
4: 284
1020445172_1020445182 5 Left 1020445172 7:8261430-8261452 CCCAAAGGAAACGGGCGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1020445182 7:8261458-8261480 GCTGGAACCGGGGTTGCTTAGGG 0: 1
1: 0
2: 0
3: 15
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445182 Original CRISPR GCTGGAACCGGGGTTGCTTA GGG Intronic
902666357 1:17941667-17941689 GCAGGAACTGGGGTTGCTGTGGG + Intergenic
907102263 1:51847715-51847737 GCGGGAACCGGGGTTGCACGAGG - Intronic
907371175 1:54004572-54004594 GCAGGAACCGGGGCTGCGTGTGG - Intergenic
909965219 1:81901065-81901087 TCTGAAACCGGAGTTGCTAATGG + Intronic
910034800 1:82777130-82777152 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
912058161 1:105631584-105631606 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
912312913 1:108641209-108641231 GCGGGAACCGGGGCTGCGTGCGG - Intronic
912824665 1:112894710-112894732 GCAGGAACCGGGGCTGCGTGTGG + Intergenic
913486086 1:119333765-119333787 GCAGGAACCAGGGCTGCTCATGG + Intergenic
913692147 1:121289453-121289475 GCGGGAACCGGGGCTGCGTGCGG - Intronic
914145408 1:144990661-144990683 GCGGGAACCGGGGCTGCGTGCGG + Intronic
916940041 1:169668067-169668089 GCAGGAACCGGGGCTGCATGCGG + Intronic
917048480 1:170890914-170890936 GCTGGAAGCGGGTTTGATTCTGG - Intergenic
918002210 1:180508613-180508635 GCTGGAACCGGGGCTGCGCGTGG + Intergenic
919167986 1:193919261-193919283 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
920479471 1:206307801-206307823 GCGGGAACCGGGGCTGCGTGCGG - Intronic
921903882 1:220476043-220476065 GCAGGAACCGGGGCTGCGTGCGG - Intergenic
922423176 1:225472718-225472740 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
923930111 1:238684979-238685001 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1066186267 10:33013303-33013325 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1068211303 10:53924194-53924216 GCGGGAACCGGGGCTGCATGTGG + Intronic
1068554989 10:58448604-58448626 GCAGGAACCGGGGCTGCATGGGG - Intergenic
1068792256 10:61040683-61040705 GCGGGAACCGGGGCTGCACACGG + Intergenic
1068902079 10:62280389-62280411 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1071797094 10:89018924-89018946 GCGGGAACCGGGGCTGCACATGG - Intergenic
1073262524 10:102201217-102201239 GCGGGAACCGGGGCTGCATGTGG - Intergenic
1073532483 10:104245186-104245208 GCGGGAACCGGGGCTGCCCACGG + Intronic
1074098097 10:110331470-110331492 CGTGGAACCGGGGCTGCTCATGG + Intergenic
1074208831 10:111309229-111309251 GCTGGAACAAGGGCTGCTAACGG - Intergenic
1077283764 11:1756932-1756954 CCTGGTCCCGGGGTTGCTGATGG - Intronic
1077607234 11:3620474-3620496 GCAGGAAAAGGAGTTGCTTAGGG - Intergenic
1080195231 11:29600495-29600517 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
1080621410 11:33990111-33990133 GCCGGAACCGGGGCTGCGTGCGG + Intergenic
1081125027 11:39311840-39311862 GCAGGAACCGGGGCTGCGTGCGG + Intergenic
1081315175 11:41622888-41622910 GCAGGAACCGGGGATGCGTGTGG + Intergenic
1083546078 11:63550217-63550239 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1084024777 11:66441082-66441104 GCGGGAACCGGGGCTGCGTGCGG - Intronic
1085254386 11:75164210-75164232 GCTGGGACAGGGGTTGCCTGAGG - Intronic
1092220263 12:6708321-6708343 GCGGGAACCGGGGCTGCGTGGGG + Intergenic
1092221365 12:6716048-6716070 GCGGGAACCGGGGCTGCGTGGGG + Intergenic
1092834234 12:12472736-12472758 GCGGGAACCGGGGCTGCGCACGG - Intergenic
1094589338 12:31806137-31806159 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
1094666453 12:32525685-32525707 GCGGGAACCGGGGCTGCGTGTGG + Intronic
1095533944 12:43224334-43224356 GCGGGAACCTGGGCTGCTCACGG + Intergenic
1095925040 12:47569978-47570000 GCTGGAGCTGGGGTTCCTGAAGG - Intergenic
1097664223 12:62461582-62461604 GCTGGAACCAGGGCTGCGTGTGG - Intergenic
1098588635 12:72185052-72185074 GCGGGAACCGGGGCTGCCTGCGG + Intronic
1098759206 12:74402958-74402980 GCGGGAACCGGGGCTGCCTGCGG + Intergenic
1099204319 12:79710949-79710971 GCGGGAACCGGGGCTGCGCATGG + Intergenic
1099790678 12:87330227-87330249 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1100521431 12:95379620-95379642 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1101008953 12:100430313-100430335 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1103146182 12:118597524-118597546 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1104582602 12:130022066-130022088 GCGGGAACCGGGGCTGCGTGTGG + Intergenic
1104614554 12:130257003-130257025 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1105883455 13:24623369-24623391 GCGGGAACCGGGGCTGCATGTGG + Intergenic
1106810913 13:33357992-33358014 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1108644012 13:52408424-52408446 GCGGGAACCGGGGCTGCGCACGG - Intergenic
1108751566 13:53452741-53452763 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1109141011 13:58714095-58714117 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1109145376 13:58773329-58773351 GCGGGAACCGGGGCTGCGCATGG + Intergenic
1109164193 13:59012956-59012978 GCTGGAAACAGGGTTGCTGCCGG + Intergenic
1109441331 13:62379238-62379260 GCGGGAACCGGGGCTGCGTGTGG + Intergenic
1110024103 13:70512254-70512276 GCGGGAACCGGGGCTGCGCACGG - Intergenic
1110417452 13:75268460-75268482 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1110497828 13:76190116-76190138 GCGGGAACCGGGGCTGCATGCGG + Intergenic
1111590989 13:90348612-90348634 GCGGGAACCGGGGCTGCGCACGG + Intergenic
1111748292 13:92296677-92296699 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1113506603 13:110821171-110821193 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1114593499 14:23891768-23891790 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1116390493 14:44384754-44384776 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1116623979 14:47242455-47242477 GCGGGAACCGGGGCTGCGTGTGG + Intronic
1117571960 14:57056964-57056986 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1120169652 14:81236110-81236132 GCGGGAACCGGGGCTGCGCATGG + Intergenic
1120844128 14:89111659-89111681 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1121521716 14:94590493-94590515 GCTGGAAACTGGGTTCCTTAGGG + Intronic
1122493494 14:102135859-102135881 GCGGGAACCGGGGCTGCGTGCGG - Intronic
1125565788 15:40677276-40677298 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1125609666 15:40961629-40961651 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1128110811 15:65075036-65075058 GCGGGAACCGGGGCTGCGTGTGG + Intronic
1128141092 15:65301422-65301444 GCAGGAACCGGGGCTGCGCACGG - Intergenic
1129280430 15:74480693-74480715 GCGGGAACCGGGGCTGCGTGAGG - Intergenic
1129859133 15:78846885-78846907 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1130346128 15:83047242-83047264 AATGGAACAGGGATTGCTTAGGG + Intronic
1132000497 15:98174565-98174587 GGTGGAACCGGGGTTGGTCTAGG - Intergenic
1132658430 16:1051094-1051116 GCTGGAGCAGGGGTGGCTGATGG + Intergenic
1136247880 16:28985667-28985689 GCAGGAACAGGGGGTGCTTAGGG - Intronic
1139125575 16:64072676-64072698 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1144467119 17:15505709-15505731 GCGGGAACCGGGGCTGCCTAGGG + Intronic
1150682480 17:67294762-67294784 GCAGGAACCGGGGCTGCGTGCGG + Intergenic
1151983205 17:77526386-77526408 GCGGGAACCGGGGCTGCCCAGGG - Intergenic
1153070345 18:1098238-1098260 GCGGGAACCGGGGCTGCGTGTGG + Intergenic
1156038632 18:32794587-32794609 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1156651914 18:39235359-39235381 GCAGGAACCAGGGTTGCGCATGG + Intergenic
1157800637 18:50617785-50617807 GATGGAAGAGGGGTGGCTTAAGG - Intronic
1157979836 18:52367252-52367274 GCGGGAACCGGGGCTGCGTGCGG - Intronic
1158705791 18:59790799-59790821 GCGGGAACCCGGGTTGCGTGCGG - Intergenic
1160176659 18:76600478-76600500 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1160989977 19:1856553-1856575 GCTGCATCCTGGGTTGCTTGGGG - Intronic
1162466288 19:10843067-10843089 GCTGGATCCGGGGCTTTTTATGG + Intronic
1162814768 19:13187057-13187079 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1163325290 19:16599689-16599711 GCTGGAACTGGGGTTCCTGAGGG - Intronic
1164270626 19:23668875-23668897 GCGGGAACCGGGGCTGCGTGCGG - Intronic
1164310423 19:24041326-24041348 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1167299783 19:48671906-48671928 GCTGGAACCTGGGTGGCTCTGGG + Intronic
1168722341 19:58561059-58561081 GCTGGAACAGGGGTTGGAAAGGG + Intergenic
925537844 2:4935662-4935684 GCGGGAACCGGGGCTGCACACGG - Intergenic
925832130 2:7906203-7906225 GCTGGAACTAGGGCTTCTTATGG - Intergenic
926097457 2:10091414-10091436 GCGGGAACCGGGGCTGCGCATGG + Intergenic
929201821 2:39244287-39244309 GCGGGAACCGGGGCTGCGCACGG + Intergenic
930338792 2:50084556-50084578 GCGGGAACCGGGGCTGCGTGCGG - Intronic
932178249 2:69622095-69622117 GCGGGAACCGGGGCTGCGCAGGG + Intronic
932486439 2:72086902-72086924 GCGGGAACCGGGGCTGCTTGCGG + Intergenic
933511500 2:83246274-83246296 GCAGGAACCGGGGCTGCGCATGG - Intergenic
935922520 2:108031575-108031597 GCGGGAACCAGGGCTGCTCACGG + Intergenic
941577453 2:167250990-167251012 ATTGGAACCGGGGTTGCTGCTGG - Exonic
941705909 2:168657787-168657809 GCGGGAACCGGGGCTGCGTGCGG - Intronic
945745744 2:213718503-213718525 GCGGGAACCGGGGCTGCCTGCGG + Intronic
946053961 2:216885261-216885283 GCGGGAACCGGGGCTGCGTGTGG + Intergenic
947932097 2:233972816-233972838 GCGGGAACCGGGGCTGCGTGTGG - Intronic
1170649465 20:18226777-18226799 GCTGGAACCAGGGCTGCGCACGG + Intergenic
1171161507 20:22928679-22928701 TCTGGAACTGTGTTTGCTTAGGG + Intergenic
1172431894 20:34899151-34899173 GCGGGAACCGGGGCTGCGCACGG - Intronic
1174162915 20:48564411-48564433 GCGGGAACCGGGGCTGCACACGG - Intergenic
1175260059 20:57668568-57668590 GCTGGACCGGGGCCTGCTTAAGG - Intronic
1175293758 20:57895033-57895055 GCTGGAATCGGGCTTCCTGATGG - Intergenic
1176189350 20:63800575-63800597 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1176362441 21:6009076-6009098 GCTGGAAGAGGGCTTGCTTAGGG + Intergenic
1176966655 21:15218924-15218946 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1177496893 21:21902429-21902451 GCAGGAACCGGGGCTGCGTGCGG + Intergenic
1177823122 21:26053512-26053534 GCAAGAAACGGAGTTGCTTAAGG - Intronic
1178585680 21:33868665-33868687 GCAGGAACCGGGGCTGCGTGCGG - Intronic
1178983389 21:37283534-37283556 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1179761077 21:43529469-43529491 GCTGGAAGAGGGCTTGCTTAGGG - Exonic
1183639609 22:39084916-39084938 GCTGGAAACGGGGTTCCTCTGGG + Intronic
1183685176 22:39357549-39357571 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1184069314 22:42138303-42138325 GCGGGAACCTGGGTTGCTCGCGG + Intergenic
1184527823 22:45035909-45035931 GCTGGAACCTGGTCAGCTTAAGG + Intergenic
1184787470 22:46678813-46678835 GCTGGTGCCGGGGGTGCTTTGGG + Exonic
950513402 3:13447545-13447567 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
955219634 3:57012895-57012917 GCAGGAACCGGGGCTGCGCACGG + Intronic
956195710 3:66651583-66651605 GCGGGAACCGGGGCTGCCCATGG + Intergenic
956479590 3:69660679-69660701 GCGGGAACCGGGGCTGCTCAGGG + Intergenic
956481423 3:69677465-69677487 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
956855223 3:73269205-73269227 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
956986936 3:74712069-74712091 GCGGGAACCGGGGCTGCACATGG + Intergenic
957419707 3:79951719-79951741 GCGGGAACCGGGGCTGCGTGTGG - Intergenic
962283785 3:134070607-134070629 GCAGGAACCGGGGCTGCGTGCGG - Intronic
962398786 3:135039777-135039799 GCGGGAACCGGGGCTGCGTGCGG - Intronic
962600542 3:136987935-136987957 GCTGGAACCGGGGCTGCACGCGG - Intronic
963397173 3:144749824-144749846 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
964139256 3:153378684-153378706 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
964580958 3:158237436-158237458 GCTGGAACATGCATTGCTTATGG - Intronic
964977725 3:162640083-162640105 GCGGGAACCGGGGCTGCATGTGG + Intergenic
965753269 3:171999219-171999241 GCAGGAACCGGGGCTGCGTTCGG - Intergenic
968181634 3:196599385-196599407 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
969043222 4:4317472-4317494 GCTGGGAAGGGGGTTGCTAATGG - Intronic
970272092 4:14358676-14358698 GCTGGAACCGGGGCTGTGCACGG + Intergenic
971280565 4:25239580-25239602 GCGGGAACTGGGGTTGCGTGTGG - Intronic
971618730 4:28828009-28828031 GCGGGAACCGGGGCTGCCCACGG + Intergenic
971811920 4:31438664-31438686 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
971905231 4:32716573-32716595 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
974128995 4:57730126-57730148 GCGGGAACCGGGGCTGCACACGG - Intergenic
974641778 4:64640821-64640843 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
976980334 4:91218317-91218339 GCAGGAACCGGGGCTGCGTGCGG - Intronic
977751000 4:100609113-100609135 GCGGGAACCGGGGCTGCGTGCGG - Intronic
979445701 4:120808914-120808936 GCGGGAACCGGGGCTGCCTGCGG - Intronic
979755839 4:124339066-124339088 GCGGGAACCGGGGTTGCGCGCGG + Intergenic
981275786 4:142897512-142897534 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
982768902 4:159378110-159378132 GCGGGAACCAGGGCTGCATACGG + Intergenic
982770112 4:159389971-159389993 GCGGGAACCGGGGCTGCGTGTGG + Intergenic
984238855 4:177193542-177193564 GCGGGAACCGGGGCTGCGCACGG - Intergenic
984948759 4:184990436-184990458 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
985087062 4:186324597-186324619 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
985412131 4:189696002-189696024 GCGGGAACCGGGGCTGTTCACGG - Intergenic
987365007 5:17140941-17140963 GCGGGAACCGGGGCTGCGTGCGG + Intronic
987876916 5:23691137-23691159 GCAGGAACCGGGGCTGCATGCGG + Intergenic
987990279 5:25200370-25200392 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
988279590 5:29127970-29127992 GCGGGAACCGGGGCCGCTTGTGG - Intergenic
988684771 5:33515734-33515756 GCGGGAACCGGGGCTGCGTGGGG - Intergenic
990418932 5:55613364-55613386 GCGGGAACCGGGGCTGCCTGTGG + Intergenic
990461489 5:56035502-56035524 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
992050330 5:72935251-72935273 GCGGGAACCGGGGCTGCACACGG + Intergenic
992296705 5:75333698-75333720 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
992947413 5:81823735-81823757 GCGGGAACCGGGGCTGCCTACGG + Intergenic
993320967 5:86467028-86467050 GCGGGAACCGGGGCTGCATGCGG - Intergenic
994605639 5:101962793-101962815 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
995112404 5:108442386-108442408 GCGGGAACCGGGGCTGCGCATGG - Intergenic
995679906 5:114704636-114704658 GCAGGAACCGGGGCTGCGTGCGG - Intergenic
995920362 5:117304674-117304696 GCGGGAACCGGGGCTGCATGCGG + Intergenic
1001636411 5:173213458-173213480 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1002221708 5:177688248-177688270 GCAGGAACCGGGGCTGCGTGCGG + Intergenic
1002535807 5:179874767-179874789 GCTGGACCCGGGGGTGCTCTGGG - Intronic
1002616412 5:180459185-180459207 GCAGGAACCGGGGCTGCGTGCGG + Intergenic
1003177250 6:3761402-3761424 GCGGGAACCGGGGCTGCTCGCGG + Intergenic
1003598083 6:7492916-7492938 GCTGGAGCCGGGGTGGCCTTTGG - Intergenic
1003881433 6:10483058-10483080 GCGGGAACCGGGGCTGCTCACGG - Intergenic
1004196618 6:13511377-13511399 GCGGGAACCGGGGTTGCGCGCGG - Intergenic
1004906180 6:20239076-20239098 GCGGGAACCGGGGCTGCGTCCGG + Intergenic
1004951879 6:20682193-20682215 GCTAGAACCAGGGTTTCTTGAGG - Intronic
1005035603 6:21552631-21552653 GCTGGAACCGGGGCTGCGTGCGG - Intergenic
1005707480 6:28469700-28469722 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1005758928 6:28950140-28950162 GCGGGAACCGGGGCTGCATGCGG - Intergenic
1006477796 6:34269039-34269061 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1008038747 6:46774612-46774634 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1008284380 6:49629896-49629918 GCGGGAACCGGGGCTGCGTGCGG - Intronic
1009685303 6:66949229-66949251 GCGGGAACCGGGGCTGCGTGGGG + Intergenic
1011021671 6:82820349-82820371 GCTGGAATCTGGGTTACTTTTGG - Intergenic
1011143656 6:84189381-84189403 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1012201856 6:96416374-96416396 GCTTGAACCTGGGAGGCTTAAGG + Intergenic
1012760537 6:103294750-103294772 GCGGGAACCGGGGCTGCGCAGGG - Intergenic
1014460284 6:121686760-121686782 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1014718529 6:124891986-124892008 GCAGGAACCGGGGCTGCATACGG + Intergenic
1015600311 6:134904744-134904766 GCAGGAACCGGGGCTGCGTGCGG + Intergenic
1016069922 6:139726695-139726717 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1016873416 6:148840750-148840772 GTTTGAACCTGTGTTGCTTAAGG + Intronic
1017298949 6:152834357-152834379 GCTGGAACTGGGGCTGCGTGCGG + Intergenic
1017537336 6:155363065-155363087 GCGGGAACCGGGGCTGCGTGAGG + Intergenic
1018624681 6:165765633-165765655 GCAGGAACCGGGGCTGCATGTGG - Intronic
1019000299 6:168744132-168744154 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1019621737 7:1995801-1995823 GCTGGCACCGGGGTTCTGTATGG - Intronic
1020445182 7:8261458-8261480 GCTGGAACCGGGGTTGCTTAGGG + Intronic
1021324088 7:19245497-19245519 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1022596270 7:31716099-31716121 GCTGGATCCAGGGCTGATTAAGG + Intergenic
1024335673 7:48203263-48203285 GCGGGAACCGGGGCTGCGTGCGG - Intronic
1026187125 7:68090761-68090783 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
1027665858 7:81042722-81042744 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1028511257 7:91627740-91627762 GCGGGAACCGGGGCTGCGCACGG - Intergenic
1029567476 7:101348588-101348610 GCAGGAACCGGGGCTGCATGCGG + Intergenic
1029988132 7:104940170-104940192 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1030600018 7:111582290-111582312 GCGGGAACCGGGGCTGCATGTGG - Intergenic
1030980714 7:116182269-116182291 GTTGGAACCGGGGCTGCGCACGG - Intergenic
1031292294 7:119951858-119951880 GCGGGAACCGGGGCTGCGTGAGG - Intergenic
1031605553 7:123763518-123763540 GCGGGAACCGGGGCTGCTCGCGG - Intergenic
1032248040 7:130230035-130230057 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1032538748 7:132686023-132686045 GCTGGGTCCGGGGTTTTTTATGG - Intronic
1033839955 7:145360982-145361004 GCTGGAACTGGGGCTGCGCACGG - Intergenic
1034097878 7:148426422-148426444 GCGGGAACCGGGGCTGCGCACGG + Intergenic
1034154981 7:148949094-148949116 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1034317244 7:150143889-150143911 GCTGGAACCTGGGAGGCTTCTGG + Intergenic
1034775508 7:153823328-153823350 GCTGGAACCTGGGAGGCTTCTGG - Intergenic
1037064979 8:14566835-14566857 GCAGGAACCGGGGCTGCACACGG + Intronic
1037241515 8:16783919-16783941 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1037912799 8:22754016-22754038 GCAGGAACGAGGGTTGCTGATGG + Intronic
1037983493 8:23272131-23272153 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1038639368 8:29311478-29311500 GCGGGAACCGGGGCTGCGCATGG + Intergenic
1039284831 8:36028839-36028861 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1039830652 8:41211238-41211260 GCAGGATCTGGGGTTGCTGAGGG - Intergenic
1040583449 8:48716333-48716355 GCTGGAACCGGGGCTGCACGTGG - Intronic
1040804312 8:51377530-51377552 GCAGGAACCGGGGCTGCACAGGG + Intronic
1043110086 8:76169621-76169643 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1044862181 8:96534157-96534179 GCAGGAACCGGGGCTGCGCACGG - Intronic
1045013043 8:97975230-97975252 GCTTGATCAGGAGTTGCTTAAGG + Intronic
1045467797 8:102485859-102485881 GCGGGAACCGGGGCTGCATGTGG - Intergenic
1046208926 8:111041185-111041207 GCGGGAACCGGGGCTGCGTACGG - Intergenic
1048420966 8:134277966-134277988 GCTGGAACGGGGGTTGTTGCAGG + Intergenic
1049230996 8:141481549-141481571 TCTAGAAATGGGGTTGCTTAGGG - Intergenic
1049472831 8:142783902-142783924 GCTGGAACTGGGGGTGGTGATGG + Intergenic
1049778434 8:144416750-144416772 GCTGGAGCTGGGGCTGCTTCTGG - Exonic
1051892660 9:21959264-21959286 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1053357968 9:37462920-37462942 GCTGGTTCCGGGGCTTCTTAGGG - Intronic
1053812075 9:41862746-41862768 GCGGGAACCGGGGCTGCGTGTGG - Intergenic
1054618520 9:67324693-67324715 GCGGGAACCGGGGCTGCGTGTGG + Intergenic
1056081005 9:83093654-83093676 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1058235719 9:102487287-102487309 GGCGGAACCGGGGCTGCTTGCGG - Intergenic
1059991599 9:119870630-119870652 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1060305408 9:122406502-122406524 GCGGGAACCGGGGCTGCGCACGG - Intergenic
1060608914 9:124942346-124942368 GATGGAACCAGAGTTCCTTAAGG - Intronic
1061483790 9:130910133-130910155 GCGGGAACCGGGGCTGCGTGCGG + Intronic
1061782736 9:133005276-133005298 GCTGGAATGGGGGTGGCTTTGGG + Intergenic
1202799637 9_KI270719v1_random:163502-163524 GCTGGAGCCGGGGGTGCTGCTGG + Intergenic
1203670463 Un_KI270755v1:6979-7001 GCGGGAACCGGGGCTGTTCACGG + Intergenic
1185782890 X:2864491-2864513 GCTGGGAGCGGAGCTGCTTAGGG - Intronic
1186323291 X:8452839-8452861 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1187005882 X:15232079-15232101 GCGGGAACCGGGGCTGCATGCGG - Intergenic
1187139008 X:16575466-16575488 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1187304570 X:18083815-18083837 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1187903978 X:24049704-24049726 GCGGGAACCGGGGCTGCATGCGG + Intergenic
1192869697 X:75173946-75173968 GCGGGAACCGGGGCTGCATGCGG - Intergenic
1192870603 X:75179866-75179888 GCGGGAACCGGGGCTGCATGCGG - Intergenic
1194118069 X:89926883-89926905 GCGGGAACCGGGGCTGCGCACGG - Intergenic
1194650863 X:96512600-96512622 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1196031815 X:111100403-111100425 GCTGGGACCGGGGATGCATGGGG - Intronic
1196582657 X:117394693-117394715 GCAGGAACCGGGGCTGCGTGCGG + Intergenic
1196662554 X:118283052-118283074 GCGGGAACCGGGGCTGCATGCGG - Intergenic
1196714573 X:118798968-118798990 GCGGGAACCGGGGCTGCGTGAGG + Intergenic
1196728973 X:118922333-118922355 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1196741483 X:119029526-119029548 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1196775165 X:119331886-119331908 GCAGGAACCGGGGCTGCGTGAGG + Intergenic
1196781503 X:119387933-119387955 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
1196794021 X:119488212-119488234 GCAGGAACCGGGGATGCATGAGG - Intergenic
1196860899 X:120026134-120026156 GCAGGAACCGGGGCTGCGTAAGG - Intergenic
1197340009 X:125255659-125255681 GCGGGAACCGGGGCTGCGTTCGG + Intergenic
1197376841 X:125690928-125690950 GCGGGAACCGGGGTTGCGTGCGG - Intergenic
1197978722 X:132194107-132194129 GTGGGAACCGGGGCTGCTCACGG + Intergenic
1198214506 X:134544779-134544801 GCTGGCACCGGGCTTCCTTCTGG + Intergenic
1199009982 X:142746072-142746094 GCGGGAACCGGGGCTGCCTGCGG - Intergenic
1199831324 X:151551536-151551558 GCGGGAACCGGGGCTGCGTGCGG - Intergenic
1201479897 Y:14428102-14428124 GCGGGAACCGGGGCTGCGTGCGG + Intergenic
1201982659 Y:19924064-19924086 GCAGGAACCGGGGCTGCGTGCGG - Intergenic