ID: 1020445183

View in Genome Browser
Species Human (GRCh38)
Location 7:8261459-8261481
Sequence CTGGAACCGGGGTTGCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445172_1020445183 6 Left 1020445172 7:8261430-8261452 CCCAAAGGAAACGGGCGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1020445183 7:8261459-8261481 CTGGAACCGGGGTTGCTTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1020445173_1020445183 5 Left 1020445173 7:8261431-8261453 CCAAAGGAAACGGGCGCGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1020445183 7:8261459-8261481 CTGGAACCGGGGTTGCTTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445183 Original CRISPR CTGGAACCGGGGTTGCTTAG GGG Intronic
903478497 1:23636674-23636696 CTGAAACCAGGGGTGCTTAGCGG + Intronic
1067539028 10:47138302-47138324 CTGGAACCCGGGTGGCCTGGCGG - Intergenic
1071512037 10:86268103-86268125 CTGAAACTGGGGCTGCTTGGTGG - Intronic
1077180267 11:1209127-1209149 CTGGCACCGTGGATGCTTAGTGG - Intergenic
1078057317 11:8018948-8018970 CCGGGACAGGGGTTGCTAAGAGG - Intergenic
1085236038 11:75016333-75016355 CTGAATCTGGGGTCGCTTAGGGG - Intronic
1085279981 11:75323760-75323782 CTGGACCCTGGGTGGCTCAGAGG - Intronic
1089278595 11:117356502-117356524 CTGGAAATGGGCTTGCTGAGAGG - Intronic
1092133931 12:6132630-6132652 CGGGAACCGGGGCTGCGCAGCGG + Intergenic
1103558660 12:121780786-121780808 CTGCAACTGGGGTGCCTTAGTGG - Exonic
1105633298 13:22193325-22193347 TTAGAAGCGGTGTTGCTTAGAGG - Intergenic
1108636407 13:52339273-52339295 GTGGAGCCGGGGGTGATTAGAGG + Intergenic
1117344583 14:54819831-54819853 CTTGAACCAGGGTGGCATAGGGG - Intergenic
1120685828 14:87535860-87535882 AGGGAGCAGGGGTTGCTTAGAGG - Intergenic
1120708560 14:87770215-87770237 GTAGAACAGGGGATGCTTAGTGG + Intergenic
1121619688 14:95337511-95337533 CTGGCAAAGGAGTTGCTTAGAGG - Intergenic
1122349094 14:101077422-101077444 CTAGAGCCGGGGTGGCTCAGCGG + Intergenic
1122929047 14:104925071-104925093 CTGGACCTGGGGTTGCTGGGAGG - Intronic
1126861941 15:52893448-52893470 CTGGAATCGGGATGGCTTTGTGG + Intergenic
1130346129 15:83047243-83047265 ATGGAACAGGGATTGCTTAGGGG + Intronic
1131831101 15:96354802-96354824 CTGGAGCCGAGGTCGCTTGGAGG - Intergenic
1132888157 16:2191474-2191496 CTGGAGCCGGGGGTGCTAACAGG + Intronic
1136409268 16:30066749-30066771 CTGGCTCCGGGGTTGCTGTGTGG + Intronic
1137731842 16:50695402-50695424 CTGAAATGGGAGTTGCTTAGCGG + Intronic
1151732151 17:75917897-75917919 CAGGAGCCGGGGTGGCTGAGAGG + Intronic
1151983204 17:77526385-77526407 CGGGAACCGGGGCTGCCCAGGGG - Intergenic
1160989976 19:1856552-1856574 CTGCATCCTGGGTTGCTTGGGGG - Intronic
1165639660 19:37373647-37373669 CTGGAACAGGGGTTCCCTTGAGG + Intronic
1166885575 19:45959066-45959088 CTGGCACCGGGCTGGCATAGAGG + Intronic
1167299784 19:48671907-48671929 CTGGAACCTGGGTGGCTCTGGGG + Intronic
928256490 2:29727347-29727369 CTGGAGCTGGGGCTTCTTAGAGG - Intronic
930992656 2:57677824-57677846 CTGACACCTGCGTTGCTTAGTGG - Intergenic
931021485 2:58049011-58049033 CTGTAACCGTGATTACTTAGTGG + Intronic
932090339 2:68800343-68800365 CAGGAAACTGGGTTGCTTTGGGG - Intronic
932486440 2:72086903-72086925 CGGGAACCGGGGCTGCTTGCGGG + Intergenic
945662174 2:212700118-212700140 CTGGACCTGGGCTTGCTTGGTGG - Intergenic
947943410 2:234078192-234078214 CTGGAGCCGGGTCTGCTTTGGGG + Intergenic
948400831 2:237683823-237683845 CTGGAAGCCAAGTTGCTTAGTGG + Intronic
1169274216 20:4222025-4222047 CTGGAACAGGGGTAGATGAGCGG + Exonic
1171149487 20:22814613-22814635 CTGGAACGGGTGTAGCTTTGTGG + Intergenic
1171461610 20:25301229-25301251 CAGGTACCTGGGTTGCTAAGGGG - Intronic
1173419557 20:42889001-42889023 CTGTAACCTGGGATGCCTAGAGG - Intronic
1179553735 21:42159696-42159718 CTGCAGCCGGGGGTGCTCAGAGG + Intergenic
1180141826 21:45897848-45897870 CTGGAACTGGGGTTCCATATAGG - Intronic
1182313722 22:29427786-29427808 CTGGAACAGGGGTTCATCAGAGG - Intergenic
1183297999 22:37043443-37043465 CTGGAAGCGGGGTTGGGGAGTGG + Intergenic
1184787471 22:46678814-46678836 CTGGTGCCGGGGGTGCTTTGGGG + Exonic
951063881 3:18241749-18241771 CTAGAACCGGAATTGCTGAGTGG - Intronic
953385835 3:42505188-42505210 CTGGGGCAGGGGTTGCTGAGAGG + Intronic
953899876 3:46833939-46833961 CTGGAGCCGGGCTCGCTTCGGGG + Exonic
954970663 3:54649208-54649230 ATGGTAATGGGGTTGCTTAGAGG + Intronic
960204888 3:114884890-114884912 CTGGTACCAGGGTTTGTTAGAGG - Intronic
961523856 3:127484188-127484210 CAGGAACCGAGGTTGCTGGGGGG + Intergenic
968510442 4:993208-993230 CTGGACTCGTGGTTTCTTAGGGG - Intronic
971322249 4:25615026-25615048 CTGTAACCGGTCTTGCCTAGTGG - Intergenic
985709055 5:1417970-1417992 CAGGAACTGGGGTTGCCTTGAGG - Intronic
1002535806 5:179874766-179874788 CTGGACCCGGGGGTGCTCTGGGG - Intronic
1006521772 6:34575057-34575079 CTAGTACCGGGATTGCTCAGAGG - Intergenic
1008394120 6:50987100-50987122 CTGGAACCCTGATTGCTCAGGGG - Intergenic
1011790880 6:90896843-90896865 TTGGAACTGGGGGTTCTTAGTGG + Intergenic
1016377617 6:143439655-143439677 CTGGAACAGTGGTTGCTTCATGG + Intronic
1019853763 7:3584446-3584468 CTGCAAACAGGGTTGCTAAGCGG + Intronic
1020445183 7:8261459-8261481 CTGGAACCGGGGTTGCTTAGGGG + Intronic
1020677902 7:11202301-11202323 CAGGAACCAGGGCTGCTTTGAGG - Intergenic
1024276457 7:47680978-47681000 CAGGAAGCGGGGGTGCTTACAGG - Intergenic
1025810179 7:64870585-64870607 CTGGAAGTGGGGTTGGTTAAAGG + Intronic
1027674437 7:81141761-81141783 CGGGAACCGGGGCTGCTTGCCGG + Intergenic
1032495450 7:132358282-132358304 CTGAAACCGGGGTTGGGTGGAGG + Intronic
1042343606 8:67705211-67705233 CTGGAAACGGGGCTGCCTTGAGG + Intronic
1043832096 8:85001899-85001921 CTTTAACAGGGATTGCTTAGAGG - Intergenic
1044321714 8:90809226-90809248 TTGGAACAAGGGTTGCTTGGTGG - Intronic
1049236137 8:141513323-141513345 CTGGAGCCTGGGCTGCTCAGAGG + Intergenic
1061186033 9:129054154-129054176 CTGGACCAGGGGTTTCTTATTGG - Intronic
1061621192 9:131812368-131812390 CTGGCACAGGGGGTGCTTAGTGG + Intergenic
1190047644 X:47125515-47125537 CTGGGACAGGGTTTGCTTTGGGG - Intergenic
1195815864 X:108886752-108886774 CTGGAACAGGGGTTGGACAGAGG + Intergenic