ID: 1020445237

View in Genome Browser
Species Human (GRCh38)
Location 7:8261695-8261717
Sequence ACCAGGGAGCTCGGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445225_1020445237 -1 Left 1020445225 7:8261673-8261695 CCCTGGACGCAAGTCCCTGCCCA 0: 1
1: 0
2: 0
3: 28
4: 242
Right 1020445237 7:8261695-8261717 ACCAGGGAGCTCGGGGTCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 184
1020445226_1020445237 -2 Left 1020445226 7:8261674-8261696 CCTGGACGCAAGTCCCTGCCCAC 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1020445237 7:8261695-8261717 ACCAGGGAGCTCGGGGTCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 184
1020445223_1020445237 29 Left 1020445223 7:8261643-8261665 CCGCGGCAGGTGAACTTGTCAAC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1020445237 7:8261695-8261717 ACCAGGGAGCTCGGGGTCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445237 Original CRISPR ACCAGGGAGCTCGGGGTCCT GGG Intronic
900174681 1:1286501-1286523 ACCAGGGCCCTCGGGAGCCTGGG + Intronic
900257949 1:1706876-1706898 ACCAGTGGCCTCGGGGGCCTGGG - Intronic
900581446 1:3411822-3411844 ACTGGGGAGCTTGGCGTCCTGGG - Exonic
901405557 1:9042738-9042760 AGCTGGGGGCTAGGGGTCCTGGG - Intronic
903328087 1:22582737-22582759 ACCAGGGTGCGGGGGGTGCTGGG - Intronic
903659781 1:24969968-24969990 ACCAGCAAGCTGGGGGACCTTGG - Intergenic
904336576 1:29801961-29801983 AGCAGGAAGGTTGGGGTCCTAGG - Intergenic
905422891 1:37860162-37860184 AGAAGGGAGCTGGGGGTCCTAGG - Intergenic
905645106 1:39619800-39619822 ACCAGGCAGCTTGTGGCCCTTGG + Intergenic
907091953 1:51733404-51733426 ACCAGGGAGCTTGGTGACCTAGG - Intronic
907337778 1:53711535-53711557 AGCAGGGAGCTCGGGCCCCGGGG + Intronic
914996474 1:152547077-152547099 AGCAGGAAGCTCAGGGCCCTGGG + Intronic
915254428 1:154615280-154615302 ACCAGGGAGCTCCAAGTCCAGGG + Intronic
916142374 1:161711043-161711065 ACCAGGGTGCTCTAAGTCCTAGG + Intronic
918004516 1:180529222-180529244 TGCAGGGAGCTGGGTGTCCTTGG + Intergenic
919601220 1:199624839-199624861 ACCAAGGAGCTCTGTGTCCTTGG + Intergenic
919847410 1:201650484-201650506 CCCAGGAAGCTCGGGTCCCTCGG - Intronic
919853262 1:201688215-201688237 ACCAAGGAGCCCAGGGTCCAAGG - Intronic
921123804 1:212159350-212159372 ACCAGGGAGCCAGGTGGCCTTGG + Intergenic
1065833963 10:29640425-29640447 ACCAGCAGGCTCGGAGTCCTGGG - Intronic
1066429529 10:35337534-35337556 GCCCGGGAGCTCGGGGTTCCCGG + Intronic
1070289204 10:75103827-75103849 CCCAGGGAACTTGGGGTCCCTGG + Intronic
1070665228 10:78337941-78337963 GACAGGAAGCTCAGGGTCCTGGG - Intergenic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1071521290 10:86332722-86332744 ACCATGGAGTTTGGGGTACTTGG - Intronic
1071618300 10:87095290-87095312 CCCAGGGAGGTCGGGGTCGGGGG + Intronic
1074185848 10:111098886-111098908 AGCAGGAGGCTCTGGGTCCTTGG - Intergenic
1074863939 10:117534414-117534436 ACCCGGGAACTGGGGGTCGTGGG - Intergenic
1075400634 10:122159092-122159114 TCCAGGGAGCTGGGGGAGCTGGG + Intronic
1076157661 10:128216031-128216053 ACCAGGGACAGCAGGGTCCTGGG + Intergenic
1076379398 10:130014833-130014855 AGCTGGGAGCTGGGGGACCTGGG + Intergenic
1077095990 11:799346-799368 GCCAGGCAGAGCGGGGTCCTTGG + Exonic
1077309965 11:1883950-1883972 ACCAAGGGGCTGGGTGTCCTGGG - Exonic
1077499644 11:2903347-2903369 TGCAGGGAGCTCGGGCTCCCAGG + Exonic
1081758424 11:45560632-45560654 GCCAGGGCGCTCTGGGCCCTCGG - Intergenic
1082811016 11:57479068-57479090 CCCAGGGAGCTCGGAGTCTGGGG + Intergenic
1082813534 11:57493526-57493548 ATCATGGAGCTGGCGGTCCTGGG + Intronic
1083424461 11:62575908-62575930 AGCAGGGAGCTGGGGGAGCTGGG + Exonic
1084326200 11:68401605-68401627 CCCAAGGGGCTCTGGGTCCTCGG - Intronic
1084513016 11:69617835-69617857 GCCAGGGGGCTCGGGGCCCTGGG - Intergenic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084574051 11:69977379-69977401 AGCAGGGAGCTTGGGGTTGTGGG - Intergenic
1087755160 11:102047477-102047499 ACTGGGGAGCTCGGGGACTTGGG + Exonic
1091399736 12:174734-174756 ACCAGGGTGCCCGGGGGCGTGGG - Exonic
1094840904 12:34342347-34342369 ACCTGGGAGCCCAGGGTCCCCGG - Intergenic
1100055499 12:90504180-90504202 ATCAGGGAGATCTGGGGCCTTGG - Intergenic
1101963404 12:109266124-109266146 ACTCGGGAGCTCTGGGTTCTGGG + Intronic
1104939956 12:132390411-132390433 GCCAGGGAGCGTGGGGTCCTTGG - Intergenic
1108114433 13:47111307-47111329 ACGTGGGAGACCGGGGTCCTTGG - Intergenic
1113851710 13:113421616-113421638 ACCTGGGAGCTGGGAGTCCGTGG + Intergenic
1114519091 14:23321708-23321730 CCCCGGGAGCTCCGGGCCCTGGG + Exonic
1122080251 14:99262209-99262231 GCCAGGGAGGGCGGGGTCCTTGG - Intronic
1123941198 15:25217462-25217484 ACAAGGGAGCTCTTGGTCCCTGG + Intergenic
1123945468 15:25236788-25236810 ACAGGGGAGCTCTTGGTCCTTGG + Intergenic
1125728048 15:41878105-41878127 CCCAGGCAGCTCAGTGTCCTGGG + Intronic
1127224788 15:56918245-56918267 TCCGGGAAGCTCGGGGACCTGGG + Intronic
1128456979 15:67836612-67836634 ACCAGGGTGCCTGGGGTCCCAGG + Intergenic
1129452370 15:75658251-75658273 ACCCAGGATCTCAGGGTCCTTGG + Exonic
1129831395 15:78673430-78673452 ACCAGACAGCTCGGGCTGCTAGG - Intronic
1132683123 16:1152031-1152053 ACCAGGGAGCTTGAGCTCCCAGG - Intergenic
1133333630 16:4991952-4991974 TCCAGGGAGCTGGGGTCCCTCGG - Exonic
1134626608 16:15726975-15726997 GCCGGGGAGCTGCGGGTCCTGGG - Exonic
1135553495 16:23416447-23416469 GCCAGGGAGCTCTGGGTCCAAGG + Intronic
1136540379 16:30924886-30924908 CCCGGGAAGCTGGGGGTCCTAGG + Intronic
1136553906 16:30996911-30996933 CTCAAGGAGTTCGGGGTCCTGGG + Intronic
1137624596 16:49899851-49899873 CCCTGGGAGCACTGGGTCCTTGG + Intergenic
1138300862 16:55928883-55928905 ACCTGGGACCTCTGAGTCCTGGG - Intronic
1138554251 16:57762762-57762784 ACCCGGGACCTCGAGGCCCTGGG + Intronic
1139559666 16:67734129-67734151 ACCAGGGTGCTAGGATTCCTGGG - Intronic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1141572398 16:84941854-84941876 TCCAGAGAGGTCCGGGTCCTGGG - Intergenic
1141749951 16:85951760-85951782 GTCAGGGAGCTAGGGGGCCTGGG + Intergenic
1141940593 16:87273537-87273559 ACCAGGGAGGTCGGGGGGCAGGG + Intronic
1142080963 16:88148586-88148608 ACCTGGGAGCTCAGGGACCCTGG - Intergenic
1142251008 16:88992113-88992135 ACCAGGCAGCTCCGGGCCCGCGG - Intergenic
1142764986 17:2059681-2059703 AGCAGCGGGGTCGGGGTCCTTGG - Exonic
1144060636 17:11580904-11580926 CTCAGGGAGATAGGGGTCCTGGG - Intergenic
1150008229 17:61482832-61482854 AACAGGGTGCTCTGGGGCCTGGG + Intronic
1150141819 17:62736725-62736747 ATCAGGCAGCCCGGGGTCTTGGG + Exonic
1150431992 17:65125804-65125826 ACCAGGGAACTGGGTGTCTTTGG - Intergenic
1151341156 17:73471834-73471856 ACCAGGGAGCTCTTGGCTCTCGG + Intronic
1152199342 17:78936017-78936039 ACCAGGGAGCTAGCGGCGCTGGG + Intergenic
1153515413 18:5896229-5896251 ACCCGGCAGCTGGGGCTCCTCGG + Intergenic
1155959858 18:31985037-31985059 GGCATGGAGCTCAGGGTCCTAGG + Intergenic
1160778643 19:868129-868151 TCCAGGGATCTGGGGGTCCTGGG + Exonic
1161588863 19:5119691-5119713 CCCAGGGAACTTGGGGTCTTCGG - Exonic
1162321604 19:9973946-9973968 CCCATGGAGCTCCAGGTCCTCGG - Exonic
1164452444 19:28378461-28378483 GCCTGGGAGCTCAGGGTCTTGGG - Intergenic
1164484564 19:28643719-28643741 TCCAGGGAGTTCTGGGTGCTTGG - Intergenic
1166979328 19:46623545-46623567 ACCAGGGCTCTCTGGGTCCACGG - Exonic
1167312549 19:48745587-48745609 ACCACGGACCCCTGGGTCCTGGG - Intronic
1168057350 19:53870512-53870534 ACCAGGAAGCTTGGGCTCCAAGG + Intronic
1168233064 19:55045378-55045400 GTCAGGGAGCTCCGGGTCCCTGG + Intronic
925086287 2:1110125-1110147 AACAGGGAGCTTTGGGACCTGGG - Intronic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
926214124 2:10893215-10893237 CCCACAGAGCTGGGGGTCCTAGG - Intergenic
931655231 2:64504888-64504910 ACCAGGGAGCCCTGGCTTCTGGG - Intergenic
932451301 2:71812359-71812381 ACTAGGGAGCTATGGGTCCTGGG + Intergenic
936463359 2:112727080-112727102 GCCAGTGAGCCCAGGGTCCTTGG + Intronic
940823772 2:158387145-158387167 TCCAAGGAGCTCTGGTTCCTTGG + Intronic
947582973 2:231333087-231333109 ACCAGGGGGCCCAGTGTCCTGGG - Intronic
948530473 2:238600468-238600490 AACATGGAGCTTGGGGTCCCTGG + Intergenic
948802468 2:240439144-240439166 ACCAGGGAGCTCAGGTGCCAAGG - Intronic
949014392 2:241701559-241701581 CCCCGGGGGCTCGGGGTCCGGGG + Intergenic
1171233581 20:23507332-23507354 GACAGGCAGCTCTGGGTCCTGGG + Intergenic
1173538460 20:43833405-43833427 AGCAGGGATCTCTGGCTCCTGGG - Intergenic
1173575737 20:44112137-44112159 CCCAGGCAGCTCTGGGACCTAGG - Exonic
1173729141 20:45316681-45316703 ACCAGGGACCGCGGGCTCCTGGG - Exonic
1174407182 20:50310102-50310124 AGCAGGCAGCTCCGGGGCCTTGG - Intergenic
1174442884 20:50569976-50569998 AGCAGGGAACTGGGTGTCCTTGG + Intronic
1175575538 20:60058043-60058065 ACCAGGGAGCTCGCCTTCCAGGG + Intronic
1175753236 20:61513554-61513576 ACCAGGGAGCACGGAATTCTGGG - Intronic
1175909090 20:62396120-62396142 ACCAGGGACCTGCGGGTGCTCGG + Intronic
1175947161 20:62564295-62564317 GCCAGGCAGGACGGGGTCCTGGG + Intronic
1176617886 21:9037979-9038001 ACCAGGGATCCCAGGGTCCCCGG + Intergenic
1176706687 21:10123458-10123480 ACCAGGGATGTCAGCGTCCTCGG - Intergenic
1177298032 21:19202438-19202460 CCCAGGGAGCTGGGGCTCTTGGG - Intergenic
1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG + Intergenic
1179808667 21:43856188-43856210 GCCACGGCGCTCGAGGTCCTGGG - Intergenic
1181523016 22:23460113-23460135 CCCAGGCAGCTGGGGGTCCCAGG - Intergenic
1183748170 22:39704175-39704197 AGGAGGGAGCTGGGGGTCCTGGG + Intergenic
1183899090 22:40991570-40991592 AGCAGGGAGGTCTGGGCCCTAGG - Intergenic
1184149619 22:42630654-42630676 ACAAGGGAGCACTGGGTCTTTGG + Intronic
1185186033 22:49400966-49400988 TCTAGGGAGGTCTGGGTCCTGGG - Intergenic
950497110 3:13340426-13340448 ACCAGAGGGCCCAGGGTCCTGGG + Intronic
950579007 3:13850689-13850711 ACCAGGGAGCTCCGGGGGCCTGG - Intronic
954460709 3:50625370-50625392 TGAAGGGAGCTCTGGGTCCTGGG + Intronic
955004912 3:54959324-54959346 TCCAGGGAGCTGGGTGTGCTTGG + Intronic
955930994 3:64056769-64056791 AACAGGGAGCTCAGGGCCATGGG - Intergenic
956747673 3:72322479-72322501 AACAGGGAGCCTGGTGTCCTGGG - Intergenic
957394716 3:79622419-79622441 ACCAGGGAGCTCAGTGTATTAGG - Intronic
958099953 3:88996879-88996901 ACCGGGGAGCTCTGGGTTCATGG - Intergenic
960617456 3:119609050-119609072 ACCAGGTAGCTCGGTGGTCTTGG + Intronic
961658328 3:128455331-128455353 TCCAGGGACCTCAGGGGCCTGGG - Intergenic
967876433 3:194271180-194271202 CCCAGGGAGCCCCAGGTCCTGGG + Intergenic
967888008 3:194346260-194346282 CCCACGGAGGCCGGGGTCCTGGG + Intronic
968188579 3:196650890-196650912 AACAGGCAGCTCAGGGTCCCAGG + Intronic
968427201 4:531963-531985 ACCAGGGAGGGCTGGGTCCTGGG - Intronic
968450702 4:674742-674764 GGCAGGGACCTGGGGGTCCTGGG + Intronic
968489419 4:882087-882109 ACAAGGGCTCGCGGGGTCCTCGG + Intronic
968540431 4:1165538-1165560 AGCATGGAGCTGGGGGTCCCTGG - Intergenic
969709476 4:8834543-8834565 TCCTGGGAGCTCGGGACCCTTGG - Intergenic
972420178 4:38879356-38879378 AACAGGGAACTAGGGGCCCTGGG + Intronic
984714038 4:182910144-182910166 ACCAGGGAGCCAGGGTTGCTTGG - Intronic
985344412 4:188987996-188988018 ACCAGCTAGCTCAGGGTCCAGGG - Intergenic
985539104 5:479569-479591 GCAAGGGAGCTCGGGGTCCTAGG + Intronic
985574315 5:666456-666478 CGCCGGGAGCTGGGGGTCCTAGG + Intronic
985640891 5:1063074-1063096 AGCATGGAGCTCTGGATCCTGGG - Intronic
990358674 5:54996316-54996338 ACCAGGAATCACGGGGTCATGGG - Intronic
991270118 5:64769201-64769223 TCTAGGGAACTTGGGGTCCTGGG + Intronic
998396538 5:141822228-141822250 TCCTGGGAGCTCTGGGGCCTTGG + Intergenic
1003074421 6:2971181-2971203 GCCTGGGCGCCCGGGGTCCTCGG + Intronic
1003498297 6:6683418-6683440 ACCAGGGAGGCCTGAGTCCTGGG - Intergenic
1004064127 6:12226320-12226342 TCCAGGGATCTAGGGCTCCTGGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006633098 6:35443368-35443390 TCCAGGGGGCTGGGGGTCTTTGG - Intergenic
1007782035 6:44259945-44259967 GCCAGGGAGCCAGGAGTCCTGGG - Intronic
1007832375 6:44648235-44648257 GCCACGGAGCTGGGGTTCCTTGG - Intergenic
1011569344 6:88717559-88717581 ACAAGGGAGCTCAGGATCCAAGG + Intronic
1014790020 6:125661923-125661945 ACTTTGGAGCACGGGGTCCTGGG + Intergenic
1015616967 6:135087540-135087562 ACTAGGGGGCTCAGGGTTCTAGG - Intronic
1015943312 6:138474065-138474087 GCCATGGATCTCGGGGTACTGGG + Intronic
1017889349 6:158626064-158626086 ACTGGGGACCTCGGGATCCTTGG + Intronic
1018050710 6:160005856-160005878 CCCAGGATGCGCGGGGTCCTGGG - Intronic
1019276811 7:180137-180159 ACCAGGGACCTGGGGCTCCGGGG - Intergenic
1019603446 7:1896539-1896561 ACCTGGGAACTCGGGATCCTGGG - Intronic
1019923905 7:4179996-4180018 ACCAGGGGGCTCAGGGCACTTGG + Intronic
1020087042 7:5316103-5316125 ACTAGGGAGCTGGAGGTCCGAGG - Intronic
1020445237 7:8261695-8261717 ACCAGGGAGCTCGGGGTCCTGGG + Intronic
1023967928 7:44972818-44972840 AGCAGGGAGCTCAGAGTCCATGG + Intronic
1024964915 7:55015794-55015816 ACTAGGTAGCTCGGGGTCAGGGG - Intergenic
1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG + Intergenic
1028967340 7:96817029-96817051 ACCAGGGAGCCCGGGGTGCGTGG - Intergenic
1029701905 7:102252731-102252753 ACCAGGGAGCTCGGGGGTTGGGG - Exonic
1032012032 7:128352922-128352944 AGCAGGGAGCTGGGGGGCCGAGG - Intronic
1032960604 7:137029169-137029191 ACCAGGGAGCTCTGCTTCTTGGG + Intergenic
1033125202 7:138701297-138701319 ACCAGGGAGCCAGGCGTCTTGGG - Intronic
1034502874 7:151462318-151462340 ACCAGGGAGCTCAGGGGCAGAGG - Intergenic
1035160248 7:156944757-156944779 TCCAGGGAGCTGGGGGTGTTTGG - Intergenic
1038447165 8:27612101-27612123 TCCAGGGAGCCTGGGGTCCCTGG + Intronic
1040108024 8:43550982-43551004 AGCGGGGAGCTTGGAGTCCTTGG - Intergenic
1049089068 8:140500535-140500557 ACCAGGTGGGTCTGGGTCCTTGG + Intergenic
1049358055 8:142198481-142198503 ACCTGGGAGCTGGGGAACCTGGG - Intergenic
1049435273 8:142583549-142583571 CCTAGGGAGCCCGGGGGCCTGGG - Intergenic
1053643983 9:40110578-40110600 ACCAGGGATGTCAGCGTCCTCGG - Intergenic
1053762170 9:41354911-41354933 ACCAGGGATGTCAGCGTCCTCGG + Intergenic
1054540766 9:66266031-66266053 ACCAGGGATGTCAGCGTCCTCGG + Intergenic
1056446374 9:86669998-86670020 GCCAGTGGGCTCAGGGTCCTGGG + Intergenic
1057876289 9:98756921-98756943 CCCAGAGAGCTCGGGGGGCTTGG - Intronic
1060895279 9:127212999-127213021 ATCTGGGTGCTCGGGGTCATCGG - Exonic
1061147281 9:128807513-128807535 ACGAGGGAGCTCGGGTTCAGTGG + Intronic
1061218727 9:129236749-129236771 TCCTGGGGGCTAGGGGTCCTGGG + Intergenic
1061598296 9:131647034-131647056 AGCAGTGAGCAGGGGGTCCTGGG - Intronic
1061960398 9:133985615-133985637 TCCAAGGAGCTCTGGTTCCTTGG - Intronic
1062269422 9:135701872-135701894 CTCAGGGGGCTCTGGGTCCTTGG - Intergenic
1062538265 9:137030343-137030365 CCGAGGAAGCTCGGGGTCCCAGG + Exonic
1203551532 Un_KI270743v1:167402-167424 ACCAGGGATCCCAGGGTCCCTGG + Intergenic
1192261870 X:69510468-69510490 AGCAGGGAGCTCAGGGCACTGGG + Intronic
1196297224 X:114012059-114012081 ACCATGGAGCTTGGGGACGTGGG + Intergenic
1199676541 X:150194534-150194556 ACCTGGGAGCTGAGGTTCCTGGG - Intergenic
1201152653 Y:11102397-11102419 ACCAGGGACACCAGGGTCCTCGG + Intergenic