ID: 1020445510

View in Genome Browser
Species Human (GRCh38)
Location 7:8262573-8262595
Sequence TGGCCACGTGGAACACCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020445510_1020445516 13 Left 1020445510 7:8262573-8262595 CCGGCAGGTGTTCCACGTGGCCA 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1020445516 7:8262609-8262631 ACAATGACCTGGCGGACAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 102
1020445510_1020445514 5 Left 1020445510 7:8262573-8262595 CCGGCAGGTGTTCCACGTGGCCA 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1020445514 7:8262601-8262623 TTTGCGTCACAATGACCTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 232
1020445510_1020445513 2 Left 1020445510 7:8262573-8262595 CCGGCAGGTGTTCCACGTGGCCA 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1020445513 7:8262598-8262620 GCGTTTGCGTCACAATGACCTGG 0: 1
1: 0
2: 1
3: 4
4: 50
1020445510_1020445515 10 Left 1020445510 7:8262573-8262595 CCGGCAGGTGTTCCACGTGGCCA 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1020445515 7:8262606-8262628 GTCACAATGACCTGGCGGACAGG 0: 1
1: 0
2: 1
3: 2
4: 71
1020445510_1020445517 14 Left 1020445510 7:8262573-8262595 CCGGCAGGTGTTCCACGTGGCCA 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1020445517 7:8262610-8262632 CAATGACCTGGCGGACAGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020445510 Original CRISPR TGGCCACGTGGAACACCTGC CGG (reversed) Intronic
902038587 1:13475692-13475714 TGGCCCCTGGGTACACCTGCTGG - Exonic
902298814 1:15486870-15486892 TGCCCACATAGACCACCTGCGGG + Intronic
902527464 1:17068540-17068562 TGGCCACCTGGAAACCCTGAGGG + Exonic
902962744 1:19976398-19976420 TGGCCACGTGGCATAGCTGAAGG + Intronic
903585908 1:24415271-24415293 TGCCCTCCTGGAACACCTGTCGG - Intronic
905105737 1:35562565-35562587 TGGCCAGGTTGGCCACCTGCTGG - Exonic
906876122 1:49541378-49541400 TGCCCACCTGGAACTCATGCTGG - Intronic
908010359 1:59769975-59769997 TCCCCACGTGGAACATTTGCTGG - Intergenic
911087718 1:93993025-93993047 TGCTCACCTGGAACACCTGATGG - Exonic
912473090 1:109919092-109919114 TGGCAACGTGTCACACATGCTGG + Intronic
913461965 1:119097119-119097141 TGGACAGGTGGAACCCCAGCTGG + Intronic
914417428 1:147496790-147496812 TGGCCACGTTCAGCAACTGCAGG + Intergenic
915593184 1:156882025-156882047 TGGTCACCTGGCTCACCTGCTGG + Intergenic
917466963 1:175288242-175288264 TGCCCCCGTGGAACAACTGGAGG + Intergenic
923636523 1:235702866-235702888 GGGCCATGTGGAACAGCTGACGG + Exonic
923930103 1:238684946-238684968 TGCCCACCTGGAACTCCAGCTGG + Intergenic
1067077636 10:43197280-43197302 TGGCCTTGGGGGACACCTGCTGG - Intronic
1068806282 10:61197410-61197432 TGGCCATTTGGAGCTCCTGCAGG - Intergenic
1071387977 10:85141444-85141466 TGCCCACCTGGAACTCCAGCTGG - Intergenic
1071416821 10:85449316-85449338 AGGCCAGGTGGATCGCCTGCTGG - Intergenic
1072569824 10:96648739-96648761 TGGCCACGCTGTACGCCTGCAGG + Exonic
1073321970 10:102621039-102621061 AGCCCACTTGGAACAGCTGCTGG - Intronic
1073565937 10:104535743-104535765 TGGCCTCTTGCAAGACCTGCTGG - Intergenic
1074503320 10:114044864-114044886 GGGCCTCGCGGAACACCCGCAGG - Exonic
1076262365 10:129077869-129077891 TCTGCACGTGGAACACCAGCAGG - Intergenic
1076417364 10:130301154-130301176 TGGCCCCGGGGACCGCCTGCCGG + Intergenic
1076417522 10:130301735-130301757 TGGCCCCGGGGACCGCCTGCCGG + Intergenic
1076713887 10:132353691-132353713 TGGCCACGGGCCACAGCTGCTGG + Intronic
1077185865 11:1235072-1235094 TGGCCCCTTGCAGCACCTGCAGG + Exonic
1077374043 11:2197372-2197394 TGGCCACCTGGACACCCTGCAGG - Intergenic
1078795796 11:14591107-14591129 TGCCCACCTGGAACTCCAGCTGG - Intronic
1080867494 11:36208194-36208216 TGGCCACGGGGAACACTTTCAGG - Intronic
1081256308 11:40900240-40900262 TGGCCAGTTGGAGCACCTTCAGG + Intronic
1081874140 11:46397356-46397378 TGGACATGTGGAAGAGCTGCTGG - Exonic
1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG + Exonic
1086669323 11:89527937-89527959 TGTCCACCTGGAAAAGCTGCAGG + Intergenic
1090030350 11:123200927-123200949 TGGCCTCCTGGAAGGCCTGCTGG - Intergenic
1090959897 11:131546896-131546918 TAGCCTGGGGGAACACCTGCGGG - Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1095292415 12:40490858-40490880 TGGACACCTGGACCATCTGCTGG + Exonic
1095775408 12:46004363-46004385 TGGCCACCTGGACCACCTCAAGG - Intergenic
1096029197 12:48396821-48396843 TGGACACGTGGAAGACAAGCTGG + Intergenic
1100166640 12:91924205-91924227 TGCCCACCTGGAACTCCAGCTGG + Intergenic
1102655812 12:114481389-114481411 TGGCCACTGGGGACAGCTGCCGG - Intergenic
1103860307 12:124007099-124007121 TGGTCACGTGGAAAATTTGCCGG + Intronic
1108771012 13:53700315-53700337 TGGGCACCTGGAAAAGCTGCAGG + Intergenic
1109142393 13:58730644-58730666 TGGCCCCTTGGAGCAGCTGCTGG + Intergenic
1113922051 13:113918743-113918765 TGGACACGGGGAACACCTGGGGG - Intergenic
1115652245 14:35411057-35411079 TGGCCACGGGTGACACGTGCAGG - Intergenic
1117741961 14:58827946-58827968 TGGCCAAGTGGAACAGCCCCAGG - Intergenic
1118287702 14:64491551-64491573 AGGCAAGGTGGAACAACTGCGGG + Intronic
1119300347 14:73566649-73566671 TGCCCACCTGGAACTCCAGCTGG + Intergenic
1120900323 14:89569812-89569834 TGGCCAAGAGCAACACCTGATGG - Intronic
1122946311 14:105011875-105011897 TGGCCACGAGGAAGACGTGGAGG - Exonic
1124380371 15:29160192-29160214 CGCCCACTTGGAACTCCTGCTGG + Intronic
1125148752 15:36506118-36506140 TGGTCTTGAGGAACACCTGCAGG - Intergenic
1126690720 15:51287058-51287080 TGTCCAGGTGGGACACCTGGTGG - Intronic
1130820481 15:87490101-87490123 TGCTCAAGTGGAACACCTGGGGG - Intergenic
1130896258 15:88172689-88172711 TGGCCACGTGCCTCACCTGCTGG - Intronic
1132129134 15:99258782-99258804 AGGCCACGTGGAACAAATGTGGG - Intronic
1132715522 16:1288278-1288300 TGCCCTCGGGGAAGACCTGCTGG - Intergenic
1133976390 16:10602247-10602269 AGGCCCTGTGGAACTCCTGCTGG - Intergenic
1135019053 16:18948278-18948300 TGCCCACTTGAATCACCTGCGGG + Intergenic
1137262642 16:46843984-46844006 CGGCGACGAGGACCACCTGCGGG - Intergenic
1141494416 16:84397193-84397215 AAGCCACGTGAAACACCTGGAGG - Intronic
1144155635 17:12497928-12497950 GGGACACGTGGGACACCTGAGGG - Intergenic
1146616320 17:34359858-34359880 TGGCAATGTGGGACACCTGGAGG + Intergenic
1147196178 17:38768316-38768338 AAGGCAGGTGGAACACCTGCAGG + Exonic
1147937697 17:44022704-44022726 TGGCCACGGGGAAGAACTGGGGG + Intronic
1150286997 17:63960286-63960308 TGGACTCGTGGCACAGCTGCTGG - Intronic
1150707684 17:67502518-67502540 TGGCCACTTGGAACACTGGATGG + Intronic
1152516316 17:80826783-80826805 TGGCCACTGGGCACACCTGTGGG + Intronic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1156863630 18:41865802-41865824 TGCCCACCTGGAACTCCAGCTGG - Intergenic
1157914722 18:51654163-51654185 TGGCCACATGTAACACATACTGG - Intergenic
1158640327 18:59198035-59198057 TGGCCAAGGGGACCACCTGGAGG + Intergenic
1160750567 19:732213-732235 TGGCCACATGAAACAGATGCAGG - Intronic
1161656135 19:5516191-5516213 TGGCCCCGAGGGACACCTGAAGG - Intergenic
1162728741 19:12705281-12705303 TGGTCACGTGGAGCAGCTGGTGG - Exonic
1163211937 19:15847286-15847308 CAGCCCAGTGGAACACCTGCCGG - Intergenic
1165792951 19:38502916-38502938 TGGGCACGTCGAACACCAGGCGG - Exonic
1166015998 19:39979884-39979906 TGGCCAGGCGGAACACATCCCGG - Exonic
1166063346 19:40341584-40341606 AGGCCACGTGGGAGACCTGCTGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167492061 19:49798742-49798764 TGCCCACCTGGCACACCTGCTGG - Intronic
926051196 2:9745968-9745990 TGACCACGTGGATCACGTCCCGG + Intergenic
928388092 2:30886412-30886434 TGCCCACCTGGAGCAGCTGCTGG + Intergenic
928701566 2:33903827-33903849 TGCCCACCTGGAACTCGTGCTGG + Intergenic
941288690 2:163647545-163647567 AGGCCAGGTGGTAGACCTGCTGG - Intronic
942004870 2:171687904-171687926 TTGCGACGTGGAACACAGGCAGG - Intronic
943835132 2:192508013-192508035 TGCCCACCTGGAACTCCAGCTGG - Intergenic
946348599 2:219131902-219131924 TTGCCACGTGTTACACCTGTTGG - Intronic
948845847 2:240682525-240682547 CGGCCATGAGGAACTCCTGCAGG + Exonic
948848011 2:240692205-240692227 CGGCCATGAGGAACTCCTGCAGG - Exonic
1169488431 20:6052493-6052515 CGGCCACCTGGAGCAGCTGCAGG - Exonic
1171422032 20:25024068-25024090 TGGCCACATGGGACACCTTTGGG - Intronic
1171739376 20:28861097-28861119 TGGACATTTGGAACACCTTCCGG - Intergenic
1175182221 20:57156668-57156690 TGGCTGCCTGGACCACCTGCAGG - Intergenic
1175899146 20:62353236-62353258 AGGCCACGTGGAAGACCTGTGGG + Exonic
1176296015 21:5073589-5073611 TGGCCACGTGGCCGCCCTGCAGG - Intergenic
1179328346 21:40373291-40373313 TGACCACCTATAACACCTGCTGG - Intronic
1179861034 21:44188532-44188554 TGGCCACGTGGCCGCCCTGCAGG + Intergenic
1179900595 21:44391496-44391518 GGGCCACGTGGTGCATCTGCAGG - Exonic
1180225274 21:46388430-46388452 CGGCCACATCGCACACCTGCGGG + Intronic
1181047738 22:20223616-20223638 TGGTCAAGTGGAACCCCAGCAGG + Intergenic
1181114843 22:20625359-20625381 TGGCCATGTGGCAGACCTGGTGG + Intergenic
1181759634 22:25049286-25049308 AGGCCACAGGGGACACCTGCTGG - Exonic
949347252 3:3088062-3088084 TGGCAACGAGGTACACCTGGGGG + Intronic
950695906 3:14701095-14701117 AGGCCACCTGGAGCATCTGCTGG - Intronic
957074061 3:75587844-75587866 TGCCCACCTGGAACTCCAGCTGG - Intergenic
957631157 3:82717205-82717227 TGGCCGTGTAGAAAACCTGCAGG - Intergenic
959422712 3:106148672-106148694 TGCCCACCTGGAACTCCAGCTGG - Intergenic
960029637 3:113044341-113044363 TGCACACCAGGAACACCTGCTGG + Intergenic
960055092 3:113271304-113271326 TGGCCACGTGGGAGGCCTCCAGG + Intronic
961683085 3:128611901-128611923 TGGCCCAGTGGACCAGCTGCAGG + Intergenic
963554636 3:146772391-146772413 TGGCCACCTGGAACTCGTGCTGG - Intergenic
965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG + Intronic
969882478 4:10186481-10186503 TGGCCTTGTGGAACACTTGCAGG + Intergenic
972796002 4:42420289-42420311 TGGCAACATGGAGCACATGCTGG + Intronic
978344515 4:107753214-107753236 TGGCAGCCTGGAACAGCTGCGGG - Intergenic
978809062 4:112830852-112830874 TGCCCACCTGGAACCCGTGCTGG - Intronic
981747707 4:148067472-148067494 TGGCCACTTGGAACACTGCCTGG - Intronic
985591232 5:766539-766561 TGGCCACTGGGCCCACCTGCAGG + Intronic
985604293 5:850222-850244 TGGCCACTGGGCCCACCTGCAGG + Intronic
986209415 5:5656568-5656590 TGGCTACGTGAGAGACCTGCGGG - Intergenic
987133822 5:14882742-14882764 TGGCCATGTGGACCACATCCTGG - Intergenic
987978812 5:25053207-25053229 TGGCCACCTGGATCTCCTGTGGG - Intergenic
988020548 5:25614870-25614892 TGGCCACCTGGAACTCAGGCTGG + Intergenic
993320959 5:86466995-86467017 TGCCCACCTGGAACTCCAGCTGG + Intergenic
997682050 5:135763628-135763650 TGGGCCAGTGGAACACCTGTTGG - Intergenic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1003226211 6:4208191-4208213 TGGCCATGTGGAACCCCAGGAGG - Intergenic
1003977674 6:11359181-11359203 TGCCCACGTGAAACCCTTGCTGG - Intronic
1005710566 6:28500252-28500274 TGGTCACCTGGAGCAACTGCAGG + Intergenic
1017858931 6:158377184-158377206 TGGCCACGTGGCAGGCGTGCTGG - Intronic
1018469538 6:164083399-164083421 TGTCCAAGAGGACCACCTGCCGG + Intergenic
1018905800 6:168075287-168075309 TCGCCACGTTGCACACTTGCTGG + Exonic
1019104968 6:169660370-169660392 CAGCAGCGTGGAACACCTGCAGG - Intronic
1019140635 6:169940183-169940205 TGGCCACGTGGGACACATTCTGG + Intergenic
1019292118 7:255966-255988 TGGCCAAGAGGAAGACCTGGCGG + Exonic
1019440493 7:1043815-1043837 GGGCCGAGTGGAACACCAGCAGG - Intronic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1021966856 7:25928467-25928489 AGGCCACGAGGCACCCCTGCAGG - Intergenic
1024139063 7:46443325-46443347 TGGCCACTGGGAACTCCTTCAGG - Intergenic
1033658525 7:143388774-143388796 TGGAGAAGTGTAACACCTGCGGG + Exonic
1033784554 7:144715363-144715385 CAACCACTTGGAACACCTGCTGG + Intronic
1034487338 7:151374195-151374217 TGGCTGCGTGGAGTACCTGCTGG - Exonic
1034889228 7:154825063-154825085 TGGCGAAATGAAACACCTGCAGG + Intronic
1037001895 8:13729726-13729748 TGTCCACTTGGAAGACCTCCAGG + Intergenic
1039345060 8:36694114-36694136 TGCCCACTTTGAACACCAGCTGG - Intergenic
1040737681 8:50530170-50530192 TGGTCACTTGGAGCACCTGCAGG - Exonic
1041623528 8:59999910-59999932 TGCCCACCTGGAACTCGTGCTGG - Intergenic
1043438901 8:80259867-80259889 TGGCCACCTTGGGCACCTGCAGG + Intergenic
1044295193 8:90519135-90519157 TGTGCACGTGGAAAAGCTGCAGG + Intergenic
1049179320 8:141212966-141212988 TGGCCACGTGCAACAAAGGCTGG + Intronic
1049401775 8:142431079-142431101 TCTCCACGTGGAAGCCCTGCAGG + Intergenic
1052362061 9:27572684-27572706 TGGCCGCGTTGAACACCACCAGG - Intronic
1053557692 9:39154828-39154850 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1053821806 9:41975116-41975138 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1054139422 9:61464123-61464145 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1054608765 9:67212292-67212314 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1055289028 9:74763034-74763056 CAGCCAGGTGGGACACCTGCAGG - Exonic
1056679939 9:88708337-88708359 TGGCCAGGGGGAACACCTCTGGG + Intergenic
1061233998 9:129331902-129331924 GTGACACGTGGAACACCTGGTGG + Intergenic
1061483798 9:130910166-130910188 TGCCCACCTGGAACTCCAGCTGG - Intronic
1062271374 9:135711283-135711305 TGGCCACCGGGAACAGATGCAGG + Intronic
1188014899 X:25097681-25097703 TGGCCATTTGGAGCACCTTCAGG - Intergenic
1190362915 X:49666143-49666165 TGGCCTAGTGGAGCAGCTGCGGG - Intergenic
1190908527 X:54751042-54751064 TGGCCACGTAGAACCCCAGGTGG + Exonic
1196412908 X:115438851-115438873 TGGCCCCATGGGAGACCTGCCGG - Intergenic
1201555263 Y:15260209-15260231 CGGCCACTTGGAACTCATGCTGG - Intergenic