ID: 1020446082 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:8269326-8269348 |
| Sequence | AGGTCCAATCCAATGTCATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020446082_1020446087 | 27 | Left | 1020446082 | 7:8269326-8269348 | CCCCATGACATTGGATTGGACCT | No data | ||
| Right | 1020446087 | 7:8269376-8269398 | AACAATGATTCTCGATCTGTGGG | No data | ||||
| 1020446082_1020446086 | 26 | Left | 1020446082 | 7:8269326-8269348 | CCCCATGACATTGGATTGGACCT | No data | ||
| Right | 1020446086 | 7:8269375-8269397 | AAACAATGATTCTCGATCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020446082 | Original CRISPR | AGGTCCAATCCAATGTCATG GGG (reversed) | Intergenic | ||