ID: 1020446084

View in Genome Browser
Species Human (GRCh38)
Location 7:8269328-8269350
Sequence GAAGGTCCAATCCAATGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020446084_1020446087 25 Left 1020446084 7:8269328-8269350 CCATGACATTGGATTGGACCTTC No data
Right 1020446087 7:8269376-8269398 AACAATGATTCTCGATCTGTGGG No data
1020446084_1020446086 24 Left 1020446084 7:8269328-8269350 CCATGACATTGGATTGGACCTTC No data
Right 1020446086 7:8269375-8269397 AAACAATGATTCTCGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020446084 Original CRISPR GAAGGTCCAATCCAATGTCA TGG (reversed) Intergenic
No off target data available for this crispr