ID: 1020446084 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:8269328-8269350 |
| Sequence | GAAGGTCCAATCCAATGTCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020446084_1020446087 | 25 | Left | 1020446084 | 7:8269328-8269350 | CCATGACATTGGATTGGACCTTC | No data | ||
| Right | 1020446087 | 7:8269376-8269398 | AACAATGATTCTCGATCTGTGGG | No data | ||||
| 1020446084_1020446086 | 24 | Left | 1020446084 | 7:8269328-8269350 | CCATGACATTGGATTGGACCTTC | No data | ||
| Right | 1020446086 | 7:8269375-8269397 | AAACAATGATTCTCGATCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020446084 | Original CRISPR | GAAGGTCCAATCCAATGTCA TGG (reversed) | Intergenic | ||