ID: 1020446085

View in Genome Browser
Species Human (GRCh38)
Location 7:8269346-8269368
Sequence ACAAACTTCATGAGAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020446085_1020446090 24 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446090 7:8269393-8269415 TGTGGGTCCCAGGACCATGAGGG No data
1020446085_1020446086 6 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446086 7:8269375-8269397 AAACAATGATTCTCGATCTGTGG No data
1020446085_1020446089 23 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446089 7:8269392-8269414 CTGTGGGTCCCAGGACCATGAGG No data
1020446085_1020446087 7 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446087 7:8269376-8269398 AACAATGATTCTCGATCTGTGGG No data
1020446085_1020446088 14 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446088 7:8269383-8269405 ATTCTCGATCTGTGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020446085 Original CRISPR ACAAACTTCATGAGAAATGA AGG (reversed) Intergenic
No off target data available for this crispr