ID: 1020446086

View in Genome Browser
Species Human (GRCh38)
Location 7:8269375-8269397
Sequence AAACAATGATTCTCGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020446084_1020446086 24 Left 1020446084 7:8269328-8269350 CCATGACATTGGATTGGACCTTC No data
Right 1020446086 7:8269375-8269397 AAACAATGATTCTCGATCTGTGG No data
1020446082_1020446086 26 Left 1020446082 7:8269326-8269348 CCCCATGACATTGGATTGGACCT No data
Right 1020446086 7:8269375-8269397 AAACAATGATTCTCGATCTGTGG No data
1020446083_1020446086 25 Left 1020446083 7:8269327-8269349 CCCATGACATTGGATTGGACCTT No data
Right 1020446086 7:8269375-8269397 AAACAATGATTCTCGATCTGTGG No data
1020446085_1020446086 6 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446086 7:8269375-8269397 AAACAATGATTCTCGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020446086 Original CRISPR AAACAATGATTCTCGATCTG TGG Intergenic
No off target data available for this crispr