ID: 1020446087

View in Genome Browser
Species Human (GRCh38)
Location 7:8269376-8269398
Sequence AACAATGATTCTCGATCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020446085_1020446087 7 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446087 7:8269376-8269398 AACAATGATTCTCGATCTGTGGG No data
1020446084_1020446087 25 Left 1020446084 7:8269328-8269350 CCATGACATTGGATTGGACCTTC No data
Right 1020446087 7:8269376-8269398 AACAATGATTCTCGATCTGTGGG No data
1020446083_1020446087 26 Left 1020446083 7:8269327-8269349 CCCATGACATTGGATTGGACCTT No data
Right 1020446087 7:8269376-8269398 AACAATGATTCTCGATCTGTGGG No data
1020446082_1020446087 27 Left 1020446082 7:8269326-8269348 CCCCATGACATTGGATTGGACCT No data
Right 1020446087 7:8269376-8269398 AACAATGATTCTCGATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020446087 Original CRISPR AACAATGATTCTCGATCTGT GGG Intergenic
No off target data available for this crispr