ID: 1020446088

View in Genome Browser
Species Human (GRCh38)
Location 7:8269383-8269405
Sequence ATTCTCGATCTGTGGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020446085_1020446088 14 Left 1020446085 7:8269346-8269368 CCTTCATTTCTCATGAAGTTTGT No data
Right 1020446088 7:8269383-8269405 ATTCTCGATCTGTGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020446088 Original CRISPR ATTCTCGATCTGTGGGTCCC AGG Intergenic
No off target data available for this crispr