ID: 1020446617

View in Genome Browser
Species Human (GRCh38)
Location 7:8275586-8275608
Sequence GAATGCATAATGTTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020446617_1020446622 7 Left 1020446617 7:8275586-8275608 CCCAGCTCAAACATTATGCATTC No data
Right 1020446622 7:8275616-8275638 AGAGATATACTTAGGCAATTAGG No data
1020446617_1020446619 -1 Left 1020446617 7:8275586-8275608 CCCAGCTCAAACATTATGCATTC No data
Right 1020446619 7:8275608-8275630 CTCCCACAAGAGATATACTTAGG No data
1020446617_1020446623 17 Left 1020446617 7:8275586-8275608 CCCAGCTCAAACATTATGCATTC No data
Right 1020446623 7:8275626-8275648 TTAGGCAATTAGGTCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020446617 Original CRISPR GAATGCATAATGTTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr