ID: 1020450425

View in Genome Browser
Species Human (GRCh38)
Location 7:8315330-8315352
Sequence ATTTGCTGCTTAGAGACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020450425_1020450429 3 Left 1020450425 7:8315330-8315352 CCTCTAGTCTCTAAGCAGCAAAT No data
Right 1020450429 7:8315356-8315378 AGCACCAGCTCTGGTAGTGGTGG No data
1020450425_1020450426 -6 Left 1020450425 7:8315330-8315352 CCTCTAGTCTCTAAGCAGCAAAT No data
Right 1020450426 7:8315347-8315369 GCAAATACCAGCACCAGCTCTGG No data
1020450425_1020450432 7 Left 1020450425 7:8315330-8315352 CCTCTAGTCTCTAAGCAGCAAAT No data
Right 1020450432 7:8315360-8315382 CCAGCTCTGGTAGTGGTGGGAGG No data
1020450425_1020450430 4 Left 1020450425 7:8315330-8315352 CCTCTAGTCTCTAAGCAGCAAAT No data
Right 1020450430 7:8315357-8315379 GCACCAGCTCTGGTAGTGGTGGG No data
1020450425_1020450434 9 Left 1020450425 7:8315330-8315352 CCTCTAGTCTCTAAGCAGCAAAT No data
Right 1020450434 7:8315362-8315384 AGCTCTGGTAGTGGTGGGAGGGG No data
1020450425_1020450433 8 Left 1020450425 7:8315330-8315352 CCTCTAGTCTCTAAGCAGCAAAT No data
Right 1020450433 7:8315361-8315383 CAGCTCTGGTAGTGGTGGGAGGG No data
1020450425_1020450427 0 Left 1020450425 7:8315330-8315352 CCTCTAGTCTCTAAGCAGCAAAT No data
Right 1020450427 7:8315353-8315375 ACCAGCACCAGCTCTGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020450425 Original CRISPR ATTTGCTGCTTAGAGACTAG AGG (reversed) Intergenic