ID: 1020453006

View in Genome Browser
Species Human (GRCh38)
Location 7:8341247-8341269
Sequence CTGATTAGAAGGGCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020453006 Original CRISPR CTGATTAGAAGGGCAGATGC TGG (reversed) Intergenic
900818756 1:4870309-4870331 CTTATAAAAAGGGGAGATGCAGG + Intergenic
901473448 1:9473313-9473335 CTGCTGTGAAGGGCAGCTGCAGG - Intergenic
901789736 1:11647925-11647947 CTGCTTGGAAGGGTAGAGGCTGG - Intergenic
902097475 1:13958617-13958639 CTAATTTGAAGGGCAGATCAGGG + Intergenic
902722621 1:18314250-18314272 CTTATGAGGAAGGCAGATGCAGG - Intronic
902785420 1:18730026-18730048 TGGATTAGAAGGGAAGAGGCAGG - Intronic
903963768 1:27073291-27073313 CTGATTGGAAGTGCAGAGGGAGG - Intergenic
911352141 1:96766095-96766117 CTGATCAGAGGTGAAGATGCTGG + Intronic
913180486 1:116316552-116316574 CTGATCACAATGGCAGATCCAGG + Intergenic
913281454 1:117189140-117189162 CTGATAAGAAGGGTAGAAGTTGG - Intronic
915090454 1:153420597-153420619 CTGATAAGGAGAGGAGATGCTGG - Exonic
915095034 1:153456496-153456518 CTGATGAGGAGAGGAGATGCTGG + Intergenic
915852399 1:159339547-159339569 CTGATTATAAGGGTATATGCTGG + Intergenic
920371190 1:205480510-205480532 GTGGTTAGAAGCACAGATGCTGG - Intergenic
920811741 1:209292415-209292437 GAGGTTAGAAGTGCAGATGCTGG - Intergenic
921100783 1:211927539-211927561 CTGTTTATAAGAGCAAATGCTGG - Intergenic
921303710 1:213774381-213774403 CTGACTAGAAGGGTGGATGAGGG - Intergenic
922987077 1:229874165-229874187 CTGATGGGAAGGGCAGAAGTGGG + Intergenic
1063052714 10:2470381-2470403 GGGATAACAAGGGCAGATGCAGG - Intergenic
1063476821 10:6336118-6336140 CTGATGAGTAGAGGAGATGCTGG + Intergenic
1064025509 10:11845685-11845707 CTGAGAGGAAGGGCAGAGGCTGG + Intronic
1065305790 10:24367263-24367285 CTGATTAGAATGGCACTTGCAGG - Intronic
1066044444 10:31583530-31583552 CTGATAAAAAGGTGAGATGCAGG + Intergenic
1070555407 10:77523518-77523540 CTGATGTCAAGGGAAGATGCTGG + Intronic
1071572805 10:86707433-86707455 GTGTCTAGGAGGGCAGATGCAGG - Intronic
1072200693 10:93156080-93156102 CTGGTTTGAAGGGGAGATGTGGG + Intergenic
1073045893 10:100637980-100638002 CTAATGAAAAGGGAAGATGCAGG + Intergenic
1073778870 10:106815251-106815273 TTTATTAGAAGGACAGAGGCCGG - Intronic
1074243454 10:111663102-111663124 ATGCTTTGAAGGCCAGATGCTGG + Intergenic
1075966571 10:126616925-126616947 CTGGTTAGAAGGGGAGGTGTGGG - Intronic
1076497633 10:130907360-130907382 CTGATCAGAAAGGCAAATTCTGG - Intergenic
1076558864 10:131348003-131348025 CTTGTCAGAAAGGCAGATGCTGG + Intergenic
1076637847 10:131894070-131894092 GTGATTAGAGGGGCACGTGCTGG - Intergenic
1077278308 11:1728375-1728397 CTGATGAGAAGGGCATCTGCGGG - Intergenic
1080196485 11:29615646-29615668 TTGATCAGAGGGGCAGATGAAGG + Intergenic
1080463888 11:32479277-32479299 GTGATTTTAAGGGCAGGTGCTGG - Intergenic
1083253408 11:61482451-61482473 CTGATGAGCAGGGCAGGGGCTGG - Intronic
1083812691 11:65114629-65114651 CAGTTGAGAAGGGCAGAGGCTGG + Intronic
1084053815 11:66618002-66618024 CTGATTCTCAGGGCAGATCCCGG + Intronic
1084617456 11:70246049-70246071 GTCATCAGAAGGGCAGGTGCAGG + Intergenic
1084785105 11:71437592-71437614 CTGCAAAGTAGGGCAGATGCCGG - Intronic
1085924619 11:81001198-81001220 ATGTTTAGAAGTGCAGATTCTGG - Intergenic
1086252789 11:84837386-84837408 CTGATGAGAAGGCAAGGTGCTGG + Intronic
1087913677 11:103782341-103782363 CTGATAAGAAGTCCAGATCCAGG - Intergenic
1088623843 11:111714221-111714243 CTGAGGAAAAGGGCACATGCAGG + Intronic
1088913551 11:114210064-114210086 CTGCTGAGAAGAGCAGATGAAGG + Intronic
1091562721 12:1627295-1627317 CTGAGGAGAGGGGCAGATGTGGG + Intronic
1094258806 12:28467098-28467120 CTGATAAGAAGGGCATACTCTGG - Intronic
1095323161 12:40854790-40854812 CTAATCAGAAGAGCAGATGGCGG + Intronic
1098217229 12:68233569-68233591 CTTATTAGAAGAGGAGATGAGGG + Intergenic
1101214280 12:102565104-102565126 CTGGTTAGAAGCTCAGATCCTGG - Intergenic
1102949979 12:117025014-117025036 CTGCTTTGAAGGTCAGAAGCAGG - Intronic
1103738163 12:123073790-123073812 GTGAGTGGTAGGGCAGATGCAGG + Intronic
1104164953 12:126219016-126219038 CTTATAAGAAGTGCAGAGGCAGG + Intergenic
1104932665 12:132348024-132348046 CTGATGAAAAGGGGAGATACAGG - Intergenic
1105660764 13:22491896-22491918 CTGATAACAAGAGCAGAGGCTGG + Intergenic
1106220832 13:27745018-27745040 CTGATTAGCATGACAGAGGCTGG + Intergenic
1106933397 13:34691512-34691534 GTGATTAGAAGCCCAGATTCTGG - Intergenic
1107452804 13:40526802-40526824 CTGTCTAGAAGTGCAGTTGCTGG - Intergenic
1110129944 13:71995312-71995334 ATGAATAGAAGGGAAGATGCAGG - Intergenic
1110569661 13:76990731-76990753 CTGATTTGAAGGGCACCTGAAGG - Exonic
1112288425 13:98124262-98124284 CTGACCACAAGGGCAGAAGCAGG - Intergenic
1115917208 14:38329299-38329321 CTTATTAGAAGGGAAGAAGAAGG + Intergenic
1119568776 14:75651442-75651464 GTGAATAAAAGGGCAGATGATGG + Exonic
1119870477 14:78012556-78012578 CTGCTTACAATGGCAGATGAGGG + Intergenic
1121010319 14:90516541-90516563 ATCATTGGAAGGGCAGATGGAGG + Intergenic
1121406814 14:93724151-93724173 CTGATTAAATGGGAAGATGCTGG - Intronic
1124363645 15:29056310-29056332 CTGTTTAAAAGGGCAGGTGGAGG + Intronic
1125050682 15:35295009-35295031 CAGAGTTGAAGGGCAGTTGCTGG + Intronic
1128293128 15:66494574-66494596 CAGATTAGCAGGAAAGATGCTGG + Intronic
1129425971 15:75463209-75463231 CTGATGTGCAGGGCAGATACTGG - Intergenic
1129705786 15:77793311-77793333 GTGATTAGAGGGGAAGAGGCAGG - Intronic
1129865388 15:78903638-78903660 CAGATTACAAGGTCAGAAGCTGG - Intergenic
1135622361 16:23967110-23967132 CTGATTTGCAGGGCAGAGACAGG - Intronic
1137968422 16:52959521-52959543 CTAATGAGAAAGGCAGAGGCTGG - Intergenic
1139582635 16:67882464-67882486 CACATTACAAGGGCCGATGCAGG + Exonic
1141321105 16:83009835-83009857 CTGATTAGAATGGCTCAGGCCGG + Intronic
1141375799 16:83529030-83529052 CAGATTAGAAGAGAAGATGGAGG + Intronic
1142937389 17:3346708-3346730 GTGAGTAGAAGAGCAGAGGCTGG - Intergenic
1144250345 17:13410032-13410054 ATGAGGAGAAGGGCAGATGTGGG + Intergenic
1144797542 17:17902460-17902482 CAGCTTGGAAGGGCACATGCAGG - Intronic
1146563217 17:33889635-33889657 CTGATTGAAAAGGCAGATGTAGG - Intronic
1148642778 17:49200877-49200899 GTGATTAGATGGGCTGCTGCGGG + Intergenic
1150301675 17:64052589-64052611 CTGATTAAAGGGGCAAATGTGGG - Intronic
1150305534 17:64081833-64081855 CTGATTCCAGGGGCAGATGGTGG + Intronic
1151298174 17:73201194-73201216 CTTATTTGAAGGGGAGTTGCTGG - Exonic
1152012662 17:77727900-77727922 CTGATGTGAAGGGCAGAGGGAGG + Intergenic
1152207380 17:78981413-78981435 CTGCTGAGAAGGGATGATGCTGG - Intergenic
1152650231 17:81489123-81489145 CTGGAGAGAAGGGCAGAGGCCGG + Intergenic
1152793412 17:82293804-82293826 CTGACGAGATGGGCTGATGCAGG - Intergenic
1161675732 19:5647500-5647522 CTGATTGGAAGAGGAGATGAAGG + Intronic
1165614027 19:37182836-37182858 CTGATTAGATGCACAGTTGCTGG - Exonic
1165823914 19:38694607-38694629 CTGAGTAGAATGGGAGGTGCTGG - Intronic
1167324892 19:48818382-48818404 CTGAGGAGGAGGGCAGAGGCTGG - Intronic
925373332 2:3363033-3363055 CCAAGGAGAAGGGCAGATGCAGG - Intronic
926065428 2:9835888-9835910 CTGATTTGAAGGGAAGTTACTGG - Intergenic
926128543 2:10286324-10286346 CTGAATAGAGAGGCAGAGGCAGG + Intergenic
926326044 2:11785752-11785774 CTGGTTGGAAGGGGAGATGGGGG - Intronic
927862727 2:26570316-26570338 CTGATCAGCAGAGCACATGCTGG - Intronic
932388257 2:71358720-71358742 CTGATCACAATGGCAGATCCAGG + Intronic
932601575 2:73130348-73130370 CTGCTTAGGAAGGCAGATCCTGG + Intronic
935662283 2:105477436-105477458 CTGGTTAGAAGTGCAGAGTCTGG - Intergenic
938861298 2:135372495-135372517 CTGGTTAAAAGGCCAGGTGCTGG + Intronic
938980537 2:136522157-136522179 GTGATTAGAAGTGGAGAGGCAGG + Intergenic
941549952 2:166902756-166902778 CTGGTTAAGAGGGCAGATCCTGG + Intronic
943699319 2:190972587-190972609 CTGATTCTAAGAGTAGATGCTGG + Intronic
945704946 2:213218344-213218366 GTGATTACAGGGGCAGATGGTGG - Intergenic
946595825 2:221304986-221305008 CTGATGAGAAGGGCTGAAGTGGG + Intergenic
946884736 2:224211542-224211564 GTGATTAAAAGGGCAGTTGATGG - Intergenic
947514607 2:230791183-230791205 CTGATTAGCAGAGCAAAGGCAGG + Intronic
1169822874 20:9733077-9733099 GTGTTTAAAAGGGCAGATACTGG + Intronic
1170941279 20:20850035-20850057 CTTATTAGAAAGGCAGAGACTGG + Intergenic
1172194217 20:33081132-33081154 ATGAGTAGATGGGTAGATGCTGG + Intronic
1172785293 20:37464609-37464631 ATGACAAGAAGGGGAGATGCAGG - Intergenic
1175136674 20:56829398-56829420 ATGATAGGAAGGGCAGCTGCTGG - Intergenic
1177860753 21:26450879-26450901 CAGAGGAGAAGGCCAGATGCCGG - Intergenic
1179633769 21:42694497-42694519 CTGATCAGAAGGGGTGATGCCGG + Intronic
1180704392 22:17800111-17800133 CTGCTCAGAAGGGCAGGGGCTGG + Intronic
1181474598 22:23160569-23160591 CTGATTGGAAGAGTAGATGCTGG + Intronic
1183991973 22:41603158-41603180 CTGGTTGGGAGGGCAGATGGGGG + Intronic
1184538512 22:45103960-45103982 CTGCCTGGAAGTGCAGATGCCGG + Intergenic
1185158065 22:49206033-49206055 CTCATAAGAAGGGGAGATGAGGG + Intergenic
953212589 3:40889289-40889311 CTGGTTAGAAATGCAGATCCTGG - Intergenic
955044141 3:55343925-55343947 CTGATTAGAAGACCTCATGCAGG - Intergenic
956742845 3:72288572-72288594 CTGTTTAGAAGAGCACATGATGG - Intergenic
958088627 3:88847076-88847098 CTGTTTAGAAGTTCAGATTCTGG - Intergenic
958860483 3:99439211-99439233 GTGATTAGAAGGGCAGAATTTGG + Intergenic
959373035 3:105553345-105553367 CTTTTTAAAAGTGCAGATGCTGG - Intronic
959996777 3:112688929-112688951 CTGAATAAAAGGGCAGGTCCAGG + Intergenic
961319406 3:126062467-126062489 CTCCTGAGAAAGGCAGATGCAGG - Intronic
961999229 3:131277702-131277724 GTGGTCAGAAGGGAAGATGCAGG + Intronic
964207304 3:154188774-154188796 CTGATGAGAAGGGCTGATGATGG + Intronic
965507658 3:169534253-169534275 ATGAGTAGAAGGACAGATGGAGG - Intronic
967510067 3:190300830-190300852 ATTATTAAAAGGGCAGATTCAGG + Intergenic
967948650 3:194823762-194823784 CAGAGAAGAAGGCCAGATGCAGG - Intergenic
971154292 4:24065224-24065246 CTGCTTGGAGGAGCAGATGCAGG - Intergenic
972592501 4:40501118-40501140 CTGCATAGAAGAGCAGCTGCTGG + Intronic
972937551 4:44156977-44156999 ATGATTTGAAGGGCATATGGAGG - Intergenic
980290272 4:130841358-130841380 CTGAGTGGATGAGCAGATGCTGG - Intergenic
982122258 4:152154563-152154585 TTTCTTAGAAGGGCAGATGGAGG - Intergenic
982560311 4:156921549-156921571 TTGATAAGAAAGACAGATGCTGG + Intronic
982685525 4:158484218-158484240 CTGATTAGAAAGACAAATACAGG + Intronic
983107241 4:163702695-163702717 CCCATTAGATTGGCAGATGCTGG - Intronic
986512258 5:8520107-8520129 CTGGTTACAACTGCAGATGCTGG - Intergenic
988676511 5:33438926-33438948 CTGATTACAAGGGGACAAGCGGG - Intergenic
990696085 5:58419263-58419285 TAGATTAGAAGGGAAGATGATGG + Intergenic
992150080 5:73894249-73894271 TTGATGAGTGGGGCAGATGCAGG - Intronic
993426350 5:87769504-87769526 CTCTTCAGAAGGGGAGATGCTGG + Intergenic
996874365 5:128224980-128225002 CAGACTAGAAGGGGAGATGGTGG - Intergenic
999092815 5:148952413-148952435 CTGCTGAGGAGGACAGATGCTGG - Intronic
1005645797 6:27837279-27837301 ATCAATAAAAGGGCAGATGCTGG - Intergenic
1008720902 6:54350510-54350532 CTGGGTAGAGTGGCAGATGCTGG - Intronic
1010952637 6:82055275-82055297 CTGATAAGAAAAGCAGAAGCAGG - Intergenic
1011348596 6:86398768-86398790 CTGTATAGAAGGCAAGATGCTGG + Intergenic
1014916557 6:127156942-127156964 TTGATTAGAATGGCAGAAACAGG - Intronic
1020453006 7:8341247-8341269 CTGATTAGAAGGGCAGATGCTGG - Intergenic
1023566298 7:41526771-41526793 CTGAGTAGAAGCACAGGTGCTGG + Intergenic
1027151743 7:75738587-75738609 CTGGGGAGAAGGGCAGAGGCGGG - Intronic
1028109771 7:86926002-86926024 CTGATTCTAAGGTCACATGCAGG - Intronic
1032265230 7:130365948-130365970 CTGGTTAGAAGGGGATGTGCCGG - Intronic
1035207506 7:157303543-157303565 CTGAAAAGAAGGGCAGAGGCCGG - Intergenic
1038369144 8:26970218-26970240 CAGATTTGAAGGGAAGATGATGG + Intergenic
1041163636 8:55070391-55070413 CTGATTAGCAGGGCACACGCTGG - Intergenic
1043306288 8:78800665-78800687 CTGATTACAAGGTCAGAATCTGG - Intronic
1045402333 8:101831700-101831722 CTGGGTAGAAGGGAAGATGCTGG - Intronic
1045628442 8:104085711-104085733 CTGATTAGAATGGAGGATACTGG + Intronic
1047233223 8:123015489-123015511 CTGATCAGAATGGCGGAGGCGGG - Exonic
1048770441 8:137889415-137889437 CTGCTTTGAAGAGCAGGTGCAGG + Intergenic
1050009728 9:1173146-1173168 GTGATAAGAAAGGCAGATGAGGG - Intergenic
1050361538 9:4835668-4835690 CTGATTAAAAGCCCAGGTGCTGG + Intronic
1051100200 9:13512782-13512804 CTCACTAGAAGCGAAGATGCAGG + Intergenic
1051850307 9:21499069-21499091 CTGATTAGAAGGCCTGACCCAGG + Intergenic
1053017050 9:34667834-34667856 CTGGTGTGAGGGGCAGATGCTGG + Intergenic
1054812113 9:69443158-69443180 CTTTTTAGAAGTGCAGATTCTGG + Intronic
1056979481 9:91295573-91295595 CTGATTAGAGTGGCGGTTGCTGG - Intronic
1058223486 9:102331465-102331487 CTGATAAGAGGGGCAATTGCAGG + Intergenic
1058649672 9:107163427-107163449 TTGATTAGAAGGGGAGAAGTAGG - Intergenic
1060188224 9:121576734-121576756 CTGGGTGGAAGGGCAGATTCTGG + Intronic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1189367994 X:40403949-40403971 ATGATAAGAAGGCCACATGCAGG + Intergenic
1193340244 X:80340263-80340285 CTTATCAGAAGGGCAGGTGAGGG + Intronic