ID: 1020457982

View in Genome Browser
Species Human (GRCh38)
Location 7:8395946-8395968
Sequence AGTCAGATCCCAGAATGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020457982_1020457984 30 Left 1020457982 7:8395946-8395968 CCAAGACATTCTGGGATCTGACT No data
Right 1020457984 7:8395999-8396021 ATGAAGGATAAAGAGAGAATTGG No data
1020457982_1020457983 14 Left 1020457982 7:8395946-8395968 CCAAGACATTCTGGGATCTGACT No data
Right 1020457983 7:8395983-8396005 CTAGTAGTAGAGAGAAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020457982 Original CRISPR AGTCAGATCCCAGAATGTCT TGG (reversed) Intergenic
No off target data available for this crispr